994 resultados para normal aging


Relevância:

20.00% 20.00%

Publicador:

Resumo:

To examine the possible age-related blood pressure (BP) deregulation in response to central hypervolemia, we measured spontaneous baroreflex sensitivity (SBRS), carotid arterial compliance (CC), and R-R interval coefficient of variation (RRICV) during basal and thermoneutral resting head-out-of-water immersion (HOWI) in 7 young (YG = 24.0 ± 0.8 years) and 6 middle-aged/older (OL = 59.3 ± 1.3 years) healthy men. Compared with basal conditions (YG = 19.6 ± 4.0 vs OL = 6.1 ± 1.5 ms/mmHg, P < 0.05), SBRS remained higher in YG than OL during rest HOWI (YG = 23.6 ± 6.6 vs OL = 9.3 ± 2.1 ms/mmHg, P < 0.05). The RRICV was significantly different between groups (YG = 6.5 ± 1.4 vs OL = 2.8 ± 0.4%, P < 0.05) under HOWI. The OL group had no increase in CC, but a significant increase in systolic BP (basal = 115.3 ± 4.4 vs water = 129.3 ± 5.3 mmHg, P < 0.05) under HOWI. In contrast, the YG group had a significant increase in CC (basal = 0.16 ± 0.01 vs water = 0.17 ± 0.02 mm²/mmHg, P < 0.05) with no changes in systolic BP. SBRS was positively related to CC (r = 0.58, P < 0.05 for basal vs r = 0.62, P < 0.05 for water). Our data suggest that age-related vagal dysfunction and reduced CC may be associated with SBRS differences between YG and OL groups, and with BP elevation during HOWI in healthy older men.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aging is accompanied by a decrease in several physiological functions that make older individuals less responsive to environmental challenges. In the present study, we analyzed the immune response of female BALB/c mice (N = 6) of different ages (from 2 to 96 weeks) and identified significant age-related alterations. Immunization with hapten-protein (trinitrophenyl-bovine serum albumin) conjugates resulted in lower antibody levels in the primary and secondary responses of old mice (72 weeks old). Moreover, young mice (2, 16, and 32 weeks old) maintained specific antibodies in their sera for longer periods after primary immunization than did old mice. However, a secondary challenge efficiently induced memory in old mice, as shown by the increased antibody levels in their sera. The number of CD4+ and CD8+ T cells in the spleen increased until 8 weeks of age but there was no change in the CD4+/CD8+ ratio with aging. Splenic T cells from old mice that had or had not been immunized were less responsive to concanavalin-A and showed reduced cytokine production compared to young mice (IL-2: 57-127 vs 367-1104 pg/mL, IFN-g: 2344-12,836 vs 752-23,106 pg/mL and IL-10: 393-2172 vs 105-2869 pg/mL in old and young mice, respectively). These data suggest that there are significant changes in the organization of the immune system throughout life. However, the relevance of these alterations for the functioning of the immune system is unknown.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Apolipoprotein E (ApoE) is one of the most extensively studied genes in the context of aging, but there are few population-based studies on ApoE polymorphism in the elderly in developing countries. The objective of the present study was to assess ApoE allele and genotype distribution in a large elderly community-based sample and its association with age, sex and skin color. Participants included 1408 subjects (80.8% of all residents aged ³60 years) residing in Bambuí city, MG, Brazil. The DNA samples were subjected to the polymerase chain reaction amplification, followed by the restriction fragment length polymorphism technique, with digestion by HhaI. Analysis was carried out taking into consideration the six ApoE genotypes (e3/e3, e3/e4, e2/e3, e4/e4, e2/e4, and e2/e2), the three ApoE alleles, and the number of ApoE4 alleles for each individual. The e3 allele predominated (80.0%), followed by e4 (13.5%) and e2 (6.5%). All six possible genotypes were observed, the e3/e3 genotype being the most frequent (63.4%). This distribution was similar to that described in other western populations. Sex was not associated with number of ApoE4 alleles. Black skin color was significantly and independently associated with the presence of two ApoE4 alleles (age-sex adjusted OR = 7.38; 95%CI = 1.93-28.25), showing that the African-Brazilian elderly have a high prevalence of the e4 allele, as observed in blacks from Africa. No association between number of ApoE4 alleles and age was found, suggesting the absence of association of ApoE genotype with mortality in this population.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Apolipoprotein E (ApoE) polymorphism influences lipid metabolism, but its association with arterial hypertension is controversial. The objective of this study was to examine the association between ApoE polymorphism and prevalent hypertension in a large unselected population of older adults. Participants from the baseline of the Bambuí Health Aging Study whose ApoE genes had been genotyped were selected for this study (N = 1406, aged 60-95 years). These subjects represented 80.7% of the total elderly residents in Bambuí city, MG, Brazil. Hypertension was defined as a systolic blood pressure ³140 mmHg and/or a diastolic blood pressure ³90 mmHg, or the use of anti-hypertensive medication. The exposure variable was the ApoE genotype as follows: e3 carriers, e3e3; e2 carriers, e2e2 or e2e3, and e4 carriers, e3e4 or e4e4. Potential confounding variables were age, gender, traditional cardiovascular risk factors, uric acid, and creatinine levels. The prevalence of hypertension was 61.3%. Compared with the e3 homozygotes, neither the e2 nor the e4 carrier status was associated with hypertension (adjusted prevalence ratios = 0.94, 95%CI = 0.83-1.07 and 0.98, 0.89-1.07, respectively). On the other hand, the e2 allele carriers had lower LDL cholesterol levels (P < 0.001) and the e4 carriers had higher LDL cholesterol levels (P = 0.036). This study provides epidemiologic evidence that the ApoE genotype is not associated with prevalent hypertension in old age.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Subclinical hypothyroidism (SHT) is a disease for which exact therapeutic approaches have not yet been established. Previous studies have suggested an association between SHT and coronary heart disease. Whether this association is related to SHT-induced changes in serum lipid levels or to endothelial dysfunction is unclear. The aim of this study was to determine endothelial function measured by the flow-mediated vasodilatation of the brachial artery and the carotid artery intima-media thickness (IMT) in a group of women with SHT compared with euthyroid subjects. Triglycerides, total cholesterol, HDL-C, LDL-C, apoprotein A (apo A), apo B, and lipoprotein(a) were also determined. Twenty-one patients with SHT (mean age: 42.4 ± 10.8 years and mean thyroid-stimulating hormone (TSH) levels: 8.2 ± 2.7 µIU/mL) and 21 euthyroid controls matched for body mass index, age and atherosclerotic risk factors (mean age: 44.2 ± 8.5 years and mean TSH levels: 1.4 ± 0.6 µIU/mL) participated in the study. Lipid parameters (except HDL-C and apo A, which were lower) and IMT values were higher in the common carotid and carotid bifurcation of SHT patients with positive serum thyroid peroxidase antibodies (TPO-Ab) (0.62 ± 0.2 and 0.62 ± 0.16 mm for the common carotid and carotid bifurcation, respectively) when compared with the negative TPO-Ab group (0.55 ± 0.24 and 0.58 ± 0.13 mm, for common carotid and carotid bifurcation, respectively). The difference was not statistically significant. We conclude that minimal thyroid dysfunction had no adverse effects on endothelial function in the population studied. Further investigation is warranted to assess whether subclinical hypothyroidism, with and without TPO-Ab-positive serology, has any effect on endothelial function.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Oral tolerance can be induced in some mouse strains by gavage or spontaneous ingestion of dietary antigens. In the present study, we determined the influence of aging and oral tolerance on the secretion of co-stimulatory molecules by dendritic cells (DC), and on the ability of DC to induce proliferation and cytokine secretion by naive T cells from BALB/c and OVA transgenic (DO11.10) mice. We observed that oral tolerance could be induced in BALB/c mice (N = 5 in each group) of all ages (8, 20, 40, 60, and 80 weeks old), although a decline in specific antibody levels was observed in the sera of both tolerized and immunized mice with advancing age (40 to 80 weeks old). DC obtained from young, adult and middle-aged (8, 20, and 40 weeks old) tolerized mice were less efficient (65, 17 and 20%, respectively) than DC from immunized mice (P < 0.05) in inducing antigen-specific proliferation of naive T cells from both BALB/c and DO11.10 young mice, or in stimulating IFN-g, IL-4 and IL-10 production. However, TGF-β levels were significantly elevated in co-cultures carried out with DC from tolerant mice (P < 0.05). DC from both immunized and tolerized old and very old (60 and 80 weeks old) mice were equally ineffective in inducing T cell proliferation and cytokine production (P < 0.05). A marked reduction in CD86+ marker expression was observed in DC isolated from both old and tolerized mice (75 and 50%, respectively). The results indicate that the aging process does not interfere with the establishment of oral tolerance in BALB/c mice, but reduces DC functions, probably due to the decline of the expression of the CD86 surface marker.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Micro-ribonucleic acids (microRNAs) are small molecules containing 20-23 nucleotides. Despite their small size, it is likely that almost every cellular process is regulated by them. Moreover, aberrant microRNA expression has been involved in the development of various diseases, including cancer. Although many data are available about the role of microRNAs in various lymphoproliferative disorders, their impact on the development of acute lymphoblastic leukemia of T-cell progenitors is largely unknown. In this review, we present recent information about how specific microRNAs are expressed and regulated during malignant T-lymphopoiesis and about their role during normal hematopoiesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The limited amount of information on the primary age-related deficiencies in the innate immune system led us to study the production of inducible nitric oxide synthase (iNOS), arginase, and cytokines in macrophages of young (8 weeks old) and old (72 weeks old) female BALB/c mice. We first evaluated iNOS and arginase inducers on peritoneal (PMΦ) and bone marrow-derived (BMMΦ) macrophages of young BALB/c and C57BL/6 mice, and then investigated their effects on macrophages of old mice. Upon stimulation with lipopolysaccharide (LPS), resident and thioglycolate-elicited PMΦ from young mice presented higher iNOS activity than those from old mice (54.4%). However, LPS-stimulated BMMΦ from old mice showed the highest NO levels (50.1%). Identical NO levels were produced by PMΦ and BMMΦ of both young and old mice stimulated with interferon-γ. Arginase activity was higher in resident and elicited PMΦ of young mice stimulated with LPS (48.8 and 32.7%, respectively) and in resident PMΦ stimulated with interleukin (IL)-4 (64%). BMMΦ of old mice, however, showed higher arginase activity after treatment with IL-4 (46.5%). In response to LPS, PMΦ from old mice showed the highest levels of IL-1α (772.3 ± 51.9 pg/mL), whereas, those from young mice produced the highest amounts of tumor necrosis factor (TNF)-α (937.2 ± 132.1 pg/mL). Only TNF-α was expressed in LPS-treated BMMΦ, and cells from old mice showed the highest levels of this cytokine (994.1 ± 49.42 pg/mL). Overall, these results suggest that macrophages from young and old mice respond differently to inflammatory stimuli, depending on the source and maturity of the cell donors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The liver is one of the target organs damaged by septic shock, wherein the spread of endotoxins begins. This study aimed to investigate the effects of exogenous normal lymph (ENL) on lipopolysaccharide (LPS)-induced liver injury in rats. Male Wistar rats were randomly divided into sham, LPS, and LPS+ENL groups. LPS (15 mg/kg) was administered intravenously via the left jugular vein to the LPS and LPS+ENL groups. At 15 min after the LPS injection, saline or ENL without cell components (5 mL/kg) was administered to the LPS and LPS+ENL groups, respectively, at a rate of 0.5 mL/min. Hepatocellular injury indices and hepatic histomorphology, as well as levels of P-selectin, intercellular adhesion molecule 1 (ICAM-1), myeloperoxidase (MPO), and Na+-K+-ATPase, were assessed in hepatic tissues. Liver tissue damage occurred after LPS injection. All levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in plasma as well as the wet/dry weight ratio of hepatic tissue in plasma increased. Similarly, P-selectin, ICAM-1, and MPO levels in hepatic tissues were elevated, whereas Na+-K+-ATPase activity in hepatocytes decreased. ENL treatment lessened hepatic tissue damage and decreased levels of AST, ALT, ICAM-1, and MPO. Meanwhile, the treatment increased the activity of Na+-K+-ATPase. These results indicated that ENL could alleviate LPS-induced liver injury, thereby suggesting an alternative therapeutic strategy for the treatment of liver injury accompanied by severe infection or sepsis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Roles of novel biomarkers was studied in progression of cutaneous squamous cell carcinoma (cSCC) as the most common metastatic skin cancer. The incidence of cSCC is increasing worldwide due to lifestyle changes such as recreational exposure to sunlight and the aging of the population. Because of an emerging need for molecular markers for the progression of cSCC, we set our goal to characterize three distinct novel markers overexpressed in cSCC cells. Our results identified overexpression of serpin peptidase inhibitor clade A member 1 (SerpinA1), EphB2 and absent in melanoma 2 (AIM2) in cSCC cell lines compared with normal human epidermal keratinocytes (NHEKs). Immunohistochemical analysis of SerpinA1, EphB2 and AIM2 revealed abundant tumor cell-specific expression of cytoplasmic SerpinA1 and AIM2 and cytoplasmic and membranous EphB2 in cSCC tumors in vivo. The staining intensity of SerpinA1, EphB2 and AIM2 was significantly stronger in cSCC as compared with carcinoma in situ (cSCCIS) and actinic keratosis (AK). Tumor cell-associated SerpinA1 and EphB2 was noted in chemically induced mouse skin SCC, and the staining intensity was stronger in mouse cSCCs than in untreated skin. AIM2 staining intensity was significantly more abundant in cSCC of organ transplant recipients (OTR) than in sporadic cSCC in vivo. EphB2 knockdown resulted in inhibition of migration in cSCC cells. In addition, knockdown of EphB2 and AIM2 was found to inhibit the proliferation and invasion of cSCC cells and to delay the growth and vascularization of cSCC xenografts in vivo. Altogether, these findings identify SerpinA1 as a novel biomarker for cSCC. In addition, characterization of the roles of EphB2 and AIM2 in the progression of cSCC was implicated them as possible therapeutic targets for the treatment of cSCC particularly in unresectable and metastatic tumors.