Exogenous normal lymph alleviates microcirculation disturbances and abnormal hemorheological properties in rats with disseminated intravascular coagulation

Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500.

Exogenous normal lymph reduces liver injury induced by lipopolysaccharides in rats

The liver is one of the target organs damaged by septic shock, wherein the spread of endotoxins begins. This study aimed to investigate the effects of exogenous normal lymph (ENL) on lipopolysaccharide (LPS)-induced liver injury in rats. Male Wistar rats were randomly divided into sham, LPS, and LPS+ENL groups. LPS (15 mg/kg) was administered intravenously via the left jugular vein to the LPS and LPS+ENL groups. At 15 min after the LPS injection, saline or ENL without cell components (5 mL/kg) was administered to the LPS and LPS+ENL groups, respectively, at a rate of 0.5 mL/min. Hepatocellular injury indices and hepatic histomorphology, as well as levels of P-selectin, intercellular adhesion molecule 1 (ICAM-1), myeloperoxidase (MPO), and Na+-K+-ATPase, were assessed in hepatic tissues. Liver tissue damage occurred after LPS injection. All levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in plasma as well as the wet/dry weight ratio of hepatic tissue in plasma increased. Similarly, P-selectin, ICAM-1, and MPO levels in hepatic tissues were elevated, whereas Na+-K+-ATPase activity in hepatocytes decreased. ENL treatment lessened hepatic tissue damage and decreased levels of AST, ALT, ICAM-1, and MPO. Meanwhile, the treatment increased the activity of Na+-K+-ATPase. These results indicated that ENL could alleviate LPS-induced liver injury, thereby suggesting an alternative therapeutic strategy for the treatment of liver injury accompanied by severe infection or sepsis.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Estrutura dos grânulos de amido de milho normal e ceroso

Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.

Estabilidade de géis de amido de milho normal, ceroso e com alto teor de amilose adicionados de gomas guar e xantana durante os processos de congelamento e descongelamento

O objetivo do presente trabalho foi estudar os efeitos das gomas guar e xantana sobre a estabilidade dos géis de amido de milho normal, ceroso e com alto teor de amilose submetidos aos processos de congelamento e descongelamento. Os géis desses amidos, com concentração total de sólidos de 10% e adicionados das gomas (0,15; 0,50; 0,85 e 1%), foram submetidos a 5 ciclos de congelamento (20 horas a -18 °C) e descongelamento (4 horas a 25 °C), com exceção dos géis com alto teor de amilose, que foram submetidos a apenas 1 ciclo, devido à perda da estrutura de gel. A determinação da sinérese (porcentagem de água liberada) foi realizada pela diferença entre a massa inicial e a massa final das amostras. O gel de amido de milho normal liberou 74,45% de água, sendo que a adição de 1% da goma xantana reduziu significativamente a sinérese para 66,43%. A adição de 0,85 e 1% da goma xantana também reduziu a sinérese dos géis de amido ceroso. O menor teor de sinérese foi obtido com a utilização de 1% de goma xantana ao gel de amido de milho com alto teor de amilose, evidenciando a ação crioprotetora desta goma.

Características qualitativas de produtos elaborados com carne de frango pálida e normal

Foram elaborados hambúrgueres e filés empanados com peitos de frango pálidos e normais e foram realizadas as seguintes análises de qualidade: cor, Perda de Peso por Cozimento (PPC), cisalhamento, Encolhimento por Fritura (EF), TBA, avaliação microbiológica e sensorial para os hambúrgueres, e TBA, análise microbiológica e análise sensorial para os filés empanados. As amostras de hambúrgueres elaboradas não diferiram significativamente (p > 0,05) nos parâmetros de coloração, EF, PPC e análise microbiológica e sensorial. Para análise de força de cisalhamento, houve diferença significativa (p < 0,05) entre os hambúrgueres no período de 7, 60 e 120 dias, sendo que os hambúrgueres elaborados com carne pálida (1,92; 1,31 e 1,46, respectivamente) apresentaram as menores médias quando comparados com os de carne normal (2,34; 1,85 e 1,73, respectivamente). Na análise de TBA, as amostras elaboradas com carne pálida também tiveram os maiores resultados com 90 a 180 dias de estocagem (5,28; 7,78; 8,89; 5,02) quando comparadas às de carne normal (2,62; 7,05; 8,08; 3,89). Para os filés empanados, não foram encontradas diferenças significativas (p > 0,05) entre a elaboração com carne de coloração normal e pálida para os parâmetros avaliados. Estes resultados demonstram que a carne pálida pode ser utilizada para a elaboração de produtos industrializados sem causar prejuízos em sua qualidade.

Caracterização físico-química, reológica, morfológica e térmica dos amidos de milho normal, ceroso e com alto teor de amilose

O objetivo do presente estudo foi avaliar os amidos de milho normal, ceroso e com alto teor de amilose, fabricados pela National Starch, por meio da determinação das suas características físico-químicas, morfológicas, térmicas e reológicas. O amido de milho com alto teor de amilose (AM) apresentou teor de amilose igual a 71%, sendo que os valores obtidos para o amido de milho normal (M) e o amido de milho ceroso (AP) foram de 27,8 e 1,8%, respectivamente. Traços de proteína e lipídios foram encontrados nas amostras. O amido de milho ceroso apresentou maior viscosidade máxima e uma menor tendência à retrogradação, se comparado ao amido de milho normal. O amido AP apresentou menor entalpia de gelatinização, como pode ser observado nas análises de calorimetria exploratória diferencial (DSC), na qual a temperatura de gelatinização foi de 75 °C e o ΔH de 3,34 J.g-1, e também na análise de RVA (Rapid Visco Analyser), em que a temperatura de pasta foi de 71 °C. Apresentando, dessa forma, valores inferiores aos verificados para os outros amidos. O valor do ΔH de retrogradação do amido AP, mostrou-se 25,8% inferior ao ΔH do amido M. O amido AM apresentou o valor de 26,38 J.g-1, demonstrando o maior envolvimento da molécula de amilose no processo de retrogradação. Isso também foi evidenciado pela medida da força dos géis: o gel de AM apresentou força 99,18% superior, retrogradando mais que os outros amidos. As análises de difração de raio X mostraram que os amidos de milho normal e ceroso apresentaram um padrão de difração do tipo A e o amido de milho com alto teor de amilose apresentou padrão do tipo B.

Retenção de aroma na secagem em atmosferas normal e modificada: desenvolvimento do sistema de estudo

Na secagem de determinados alimentos, como frutas, juntamente com a água há também a evaporação de outras substâncias voláteis presentes em quantidades menores. Por isso, torna-se interessante considerar nos estudos de secagem a evaporação, além da água, desses outros componentes voláteis. A modificação da atmosfera tem sido utilizada em armazenamento, principalmente de vegetais, mas pode também ser estendida à secagem, pois pode influenciar a perda de voláteis responsáveis pelas características sensoriais do produto final. No presente trabalho, é apresentado um sistema de secagem previamente desenvolvido, no qual a atmosfera de secagem pode ser modificada pela adição de gases ou líquidos. Desenvolveu-se um sistema-modelo a partir da composição química básica do abacaxi e da adição de outros compostos, contendo um dos principais componentes do aroma desta fruta (hexanoato de etila). Além disso, também foi desenvolvida a metodologia analítica de determinação do aroma no sistema-modelo e no abacaxi, a partir dos estudos de extração de aromas e de análise cromatográfica gasosa. O aroma presente no sistema-modelo foi extraído em hexano e os componentes voláteis do aroma do abacaxi foram extraídos em éter etílico

Coolability of porous core debris beds : Effects of bed geometry and multi-dimensional flooding

This thesis addresses the coolability of porous debris beds in the context of severe accident management of nuclear power reactors. In a hypothetical severe accident at a Nordic-type boiling water reactor, the lower drywell of the containment is flooded, for the purpose of cooling the core melt discharged from the reactor pressure vessel in a water pool. The melt is fragmented and solidified in the pool, ultimately forming a porous debris bed that generates decay heat. The properties of the bed determine the limiting value for the heat flux that can be removed from the debris to the surrounding water without the risk of re-melting. The coolability of porous debris beds has been investigated experimentally by measuring the dryout power in electrically heated test beds that have different geometries. The geometries represent the debris bed shapes that may form in an accident scenario. The focus is especially on heap-like, realistic geometries which facilitate the multi-dimensional infiltration (flooding) of coolant into the bed. Spherical and irregular particles have been used to simulate the debris. The experiments have been modeled using 2D and 3D simulation codes applicable to fluid flow and heat transfer in porous media. Based on the experimental and simulation results, an interpretation of the dryout behavior in complex debris bed geometries is presented, and the validity of the codes and models for dryout predictions is evaluated. According to the experimental and simulation results, the coolability of the debris bed depends on both the flooding mode and the height of the bed. In the experiments, it was found that multi-dimensional flooding increases the dryout heat flux and coolability in a heap-shaped debris bed by 47–58% compared to the dryout heat flux of a classical, top-flooded bed of the same height. However, heap-like beds are higher than flat, top-flooded beds, which results in the formation of larger steam flux at the top of the bed. This counteracts the effect of the multi-dimensional flooding. Based on the measured dryout heat fluxes, the maximum height of a heap-like bed can only be about 1.5 times the height of a top-flooded, cylindrical bed in order to preserve the direct benefit from the multi-dimensional flooding. In addition, studies were conducted to evaluate the hydrodynamically representative effective particle diameter, which is applied in simulation models to describe debris beds that consist of irregular particles with considerable size variation. The results suggest that the effective diameter is small, closest to the mean diameter based on the number or length of particles.

Cardiac Imaging in the Diagnosis of Coronary Artery Disease: The Value of Quantitative Imaging of Myocardial Perfusion and Deformation

Atherosclerosis is a chronic and progressive disease of the vasculature. Increasing coronary atherosclerosis can lead to obstructive coronary artery disease (CAD) or myocardial infarction. Computed tomography angiography (CTA) allows noninvasive assessment of coronary anatomy and quantitation of atherosclerotic burden. Myocardial blood flow (MBF) can be accurately measured in absolute terms (mL/g/min) by positron emission tomography (PET) with [15O] H O as a radiotracer. We studied the coronary microvascular dysfunction as a risk factor for future coronary calcification in healthy young men by measuring the coronary flow reserve (CFR) which is the ratio between resting and hyperemic MBF. Impaired vasodilator function was not linked with accelerated atherosclerosis 11 years later. Currently, there is a global interest in quantitative PET perfusion imaging. We established optimal thresholds of [15O] H O PET perfusion for diagnosis of CAD (hyperemic MBF of 2.3 mL/g/min and CFR of 2.5) in the first multicenter study of this type (Turku, Amsterdam and Uppsala). In myocardial bridging a segment of the coronary artery travels inside the myocardium and can be seen as intramural course (CTA) or systolic compression (invasive coronary angiography). Myocardial bridging is frequently linked with proximal atherosclerotic plaques. We used quantitative [15O] H O PET perfusion to evaluate the hemodynamic effects of myocardial bridging. Myocardial bridging was not associated with decreased absolute MBF or increased atherosclerotic burden. Speckle tracking allows quantitative echocardiographic imaging of myocardial deformation. Speckle tracking during dobutamine stress echocardiography was feasible and comparable to subjective wall motion analysis in the diagnosis of CAD. In addition, it correctly risk stratified patients with multivessel disease and extensive ischemia.

代微積拾級Dai wei ji shi ji.Loomis' Analytical Geometry and Differential and Integral Calculus.

Traduction de Wylie, rédigée par Li Shan lan ; préfaces Chinoises des deux traducteurs (1859) ; préface anglaise, écrite à Shang hai par A. Wylie (juillet 1859). Liste de termes techniques en anglais et en Chinois. Gravé à la maison Mo hai (1859).18 livres.

Ministère de la Guerre. Direction du Génie. Bureau du personnel. Instruction du 31 décembre 1919 pour l'admission à l'Ecole polytechnique en 1920 (concours normal). Additif du 31 janvier 1920 à l'instruction du 31 décembre 1919 pour l'admission à l'Ecole polytechnique en 1920 (concours normal). Instruction du 31 décembre 1919 pour l'admission à l'Ecole polytechnique en 1920 (concours spécial)

[Ecole polytechnique]