991 resultados para combined delivery
Resumo:
A construction algorithm for multioutput radial basis function (RBF) network modelling is introduced by combining a locally regularised orthogonal least squares (LROLS) model selection with a D-optimality experimental design. The proposed algorithm aims to achieve maximised model robustness and sparsity via two effective and complementary approaches. The LROLS method alone is capable of producing a very parsimonious RBF network model with excellent generalisation performance. The D-optimality design criterion enhances the model efficiency and robustness. A further advantage of the combined approach is that the user only needs to specify a weighting for the D-optimality cost in the combined RBF model selecting criterion and the entire model construction procedure becomes automatic. The value of this weighting does not influence the model selection procedure critically and it can be chosen with ease from a wide range of values.
Resumo:
The note proposes an efficient nonlinear identification algorithm by combining a locally regularized orthogonal least squares (LROLS) model selection with a D-optimality experimental design. The proposed algorithm aims to achieve maximized model robustness and sparsity via two effective and complementary approaches. The LROLS method alone is capable of producing a very parsimonious model with excellent generalization performance. The D-optimality design criterion further enhances the model efficiency and robustness. An added advantage is that the user only needs to specify a weighting for the D-optimality cost in the combined model selecting criterion and the entire model construction procedure becomes automatic. The value of this weighting does not influence the model selection procedure critically and it can be chosen with ease from a wide range of values.
Resumo:
A new robust neurofuzzy model construction algorithm has been introduced for the modeling of a priori unknown dynamical systems from observed finite data sets in the form of a set of fuzzy rules. Based on a Takagi-Sugeno (T-S) inference mechanism a one to one mapping between a fuzzy rule base and a model matrix feature subspace is established. This link enables rule based knowledge to be extracted from matrix subspace to enhance model transparency. In order to achieve maximized model robustness and sparsity, a new robust extended Gram-Schmidt (G-S) method has been introduced via two effective and complementary approaches of regularization and D-optimality experimental design. Model rule bases are decomposed into orthogonal subspaces, so as to enhance model transparency with the capability of interpreting the derived rule base energy level. A locally regularized orthogonal least squares algorithm, combined with a D-optimality used for subspace based rule selection, has been extended for fuzzy rule regularization and subspace based information extraction. By using a weighting for the D-optimality cost function, the entire model construction procedure becomes automatic. Numerical examples are included to demonstrate the effectiveness of the proposed new algorithm.
Resumo:
There is growing interest, especially for trials in stroke, in combining multiple endpoints in a single clinical evaluation of an experimental treatment. The endpoints might be repeated evaluations of the same characteristic or alternative measures of progress on different scales. Often they will be binary or ordinal, and those are the cases studied here. In this paper we take a direct approach to combining the univariate score statistics for comparing treatments with respect to each endpoint. The correlations between the score statistics are derived and used to allow a valid combined score test to be applied. A sample size formula is deduced and application in sequential designs is discussed. The method is compared with an alternative approach based on generalized estimating equations in an illustrative analysis and replicated simulations, and the advantages and disadvantages of the two approaches are discussed.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
In this paper, data from spaceborne radar, lidar and infrared radiometers on the “A-Train” of satellites are combined in a variational algorithm to retrieve ice cloud properties. The method allows a seamless retrieval between regions where both radar and lidar are sensitive to the regions where one detects the cloud. We first implement a cloud phase identification method, including identification of supercooled water layers using the lidar signal and temperature to discriminate ice from liquid. We also include rigorous calculation of errors assigned in the variational scheme. We estimate the impact of the microphysical assumptions on the algorithm when radiances are not assimilated by evaluating the impact of the change in the area-diameter and the density-diameter relationships in the retrieval of cloud properties. We show that changes to these assumptions affect the radar-only and lidar-only retrieval more than the radar-lidar retrieval, although the lidar-only extinction retrieval is only weakly affected. We also show that making use of the molecular lidar signal beyond the cloud as a constraint on optical depth, when ice clouds are sufficiently thin to allow the lidar signal to penetrate them entirely, improves the retrieved extinction. When infrared radiances are available, they provide an extra constraint and allow the extinction-to-backscatter ratio to vary linearly with height instead of being constant, which improves the vertical distribution of retrieved cloud properties.
Resumo:
There has been significant interest in the methodologies of controlled release for a diverse range of applications spanning drug delivery, biological and chemical sensors, and diagnostics. The advancement in novel substrate-polymer coupling moieties has led to the discovery of self-immolative linkers. This new class of linker has gained popularity in recent years in polymeric release technology as a result of stable bond formation between protecting and leaving groups, which becomes labile upon activation, leading to the rapid disassembly of the parent polymer. This ability has prompted numerous studies into the design and development of self-immolative linkers and the kinetics surrounding their disassembly. This review details the main concepts that underpin self-immolative linker technologies that feature in polymeric or dendritic conjugate systems and outlines the chemistries of amplified self-immolative elimination.
Resumo:
A micellar nanocontainer delivery and release system is designed on the basis of a peptide-polymer conjugate. The hybrid molecules self-assemble into micelles comprising a modified amyloid peptide core surrounded by a PEG corona. The modified amyloid peptide previously studied in our group forms helical ribbons based on a beta-sheet motif and contains beta-amino acids that are excluded from the beta-sheet structure, thus being potentially useful as fibrillization inhibitors. In the model peptide-PEG hybrid system studied, enzymatic degradation using alpha-chymotrypsin leads to selective cleavage close to the PEG-peptide linkage, break up of the micelles, and release of peptides in unassociated form. The release of monomeric peptide is useful because aggregation of the released peptide into beta-sheet amyloid fibrils is not observed. This concept has considerable potential in the targeted delivery of peptides for therapeutic applications.
Resumo:
The structure of the chiral kinked Pt{531} surface has been determined by low-energy electron diffraction intensity-versus-energy (LEED-IV) analysis and density functional theory (DFT). Large contractions and expansions of the vertical interlayer distances with respect to the bulk-terminated surface geometry were found for the first six layers (LEED: d(12) = 0.44 angstrom, d(23) = 0.69 angstrom, d(34) = 0.49 angstrom, d(45) = 0.95 angstrom, d(56) = 0.56 angstrom; DFT: d(12) = 0.51 angstrom, d(23) = 0.55 angstrom, d(34) = 0.74 angstrom, d(45) = 0.78 angstrom, d(56) = 0.63 angstrom; d(bulk) = 0.66 angstrom). Energy-dependent cancellations of LEED spots over unusually large energy ranges, up to 100 eV, can be explained by surface roughness and reproduced by applying a model involving 0.25 ML of vacancies and adatoms in the scattering calculations. The agreement between the results from LEED and DFT is not as good as in other cases, which could be due to this roughness of the real surface.
Resumo:
A major infrastructure project is used to investigate the role of digital objects in the coordination of engineering design work. From a practice-based perspective, research emphasizes objects as important in enabling cooperative knowledge work and knowledge sharing. The term ‘boundary object’ has become used in the analysis of mutual and reciprocal knowledge sharing around physical and digital objects. The aim is to extend this work by analysing the introduction of an extranet into the public–private partnership project used to construct a new motorway. Multiple categories of digital objects are mobilized in coordination across heterogeneous, cross-organizational groups. The main findings are that digital objects provide mechanisms for accountability and control, as well as for mutual and reciprocal knowledge sharing; and that different types of objects are nested, forming a digital infrastructure for project delivery. Reconceptualizing boundary objects as a digital infrastructure for delivery has practical implications for management practices on large projects and for the use of digital tools, such as building information models, in construction. It provides a starting point for future research into the changing nature of digitally enabled coordination in project-based work.