Transcription profiling of signal transduction-related genes in sugarcane tissues

A collection of 237,954 sugarcane ESTs was examined in search of signal transduction genes. Over 3,500 components involved in several aspects of signal transduction, transcription, development, cell cycle, stress responses and pathogen interaction were compiled into the Sugarcane Signal Transduction (SUCAST) Catalogue. Sequence comparisons and protein domain analysis revealed 477 receptors, 510 protein kinases, 107 protein phosphatases, 75 small GTPases, 17 G-proteins, 114 calcium and inositol metabolism proteins, and over 600 transcription factors. The elements were distributed into 29 main categories subdivided into 409 sub-categories. Genes with no matches in the public databases and of unknown function were also catalogued. A cDNA microarray was constructed to profile individual variation of plants cultivated in the field and transcript abundance in six plant organs (flowers, roots, leaves, lateral buds, and 1(st) and 4(th) internodes). From 1280 distinct elements analyzed, 217 (17%) presented differential expression in two biological samples of at least one of the tissues tested. A total of 153 genes (12%) presented highly similar expression levels in all tissues. A virtual profile matrix was constructed and the expression profiles were validated by real-time PCR. The expression data presented can aid in assigning function for the sugarcane genes and be useful for promoter characterization of this and other economically important grasses.

High-level production of functional muscle alpha-tropomyosin in Pichia pastoris

Although numerous studies have reported the production of skeletal muscle alpha -tropomyosin in E. coli, the protein needs to be modified at the amino terminus in order to be active. Without these modifications the protein does not bind to actin, does not exhibit head-to-tail polymerization, and does not inhibit the actomyosin Mg2+-ATPase in the absence of troponin. on the other hand, the protein produced in insect cells using baculovirus as an expression vector (Urbancikova, M., and Hitchcock-DeGregori, S. E., J. Biol. Chem., 269, 24310-24315, 1994) is only partially acetylated at its amino terminal and therefore is not totally functional. In an attempt to produce an unmodified functional recombinant muscle alpha -tropomyosin for structure-function correlation studies we have expressed the chicken skeletal alpha -tropomyosin cDNA in the yeast Pichia pastoris. Recombinant protein was produced at a high level (20 mg/L) and was similar to the wild type muscle protein in its ability to polymerize, to bind to actin and to regulate the actomyosin S1 Mg2+-ATPase. (C) 2001 Academic Press.

Análise do perfil de expressão dos genes da cana-de-açúcar envolvidos na interação com Leifsonia xyli subsp: xyli

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Analysis of gene expression profiles under water stress in tolerant and sensitive sugarcane plants

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Cellular and molecular characterization of an embryonic cell line (BME26) from the tick Rhipicephalus (Boophilus) microplus

The cellular and molecular characteristics of a cell line (BME26) derived from embryos of the cattle tick Rhipicephalus (Boophilus) microplus were studied. The cells contained glycogen inclusions, numerous mitochondria, and vesicles with heterogeneous electron densities dispersed throughout the cytoplasm. Vesicles contained lipids and sequestered palladium meso-porphyrin (Pd-mP) and rhodamine-hemoglobin, suggesting their involvement in the autophagic and endocytic pathways. The cells phagocytosed yeast and expressed genes encoding the antimicrobial peptides (microplusin and defensin). A cDNA library was made and 898 unique mRNA sequences were obtained. Among them, 556 sequences were not significantly similar to any sequence found in public databases. Annotation using Gene Ontology revealed transcripts related to several different functional classes. We identified transcripts involved in immune response such as ferritin, serine proteases, protease inhibitors,. antimicrobial peptides, heat shock protein, glutathione S-transferase, peroxidase, and NADPH oxidase. BME26 cells transfected with a plasmid carrying a red fluorescent protein reporter gene (DsRed2) transiently expressed DsRed2 for up to 5 weeks. We conclude that BME26 can be used to experimentally analyze diverse biological processes that occur in R. (B.) microplus such as the innate immune response to tick-borne pathogens. (C) 2008 Elsevier Ltd. All rights reserved.

New genes of Xanthomonas citri subsp citri involved in pathogenesis and adaptation revealed by a transposon-based mutant library

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Genes diferencialmente expressos em cana-de-açúcar inoculada com Xanthomonas albilineans, o agente causal da escaldadura da folha

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Specific detection of Lettuce mosaic virus isolates belonging to the Most type

Lettuce mosaic virus (LMV)-Most isolates can infect and are seed-borne in cultivars containing the mol gene. A reverse transcription and polymerase chain reaction (RT-PCR)-based test was developed for the specific detection of LMV-Most isolates. Based on the complete genome sequences of three LMV isolates belonging respectively to the Most type, the Common type and neither of these two types, three different assays were compared: (i) presence of a diagnostic restriction site in the region of the genome encoding the variable N-terminus of the capsid protein, in the 3' end of the genome, (ii) RT-PCR using primers designed to amplify a cDNA corresponding to a portion of the P1 coding region, in the 5' end of the genome and (iii) RT-PCR using primers designed to amplify a central region of the genome. The assays were performed against a collection of 21 isolates from different geographical origins and representing the molecular variability of LMV. RT-PCR of the central region of the genome was preferred because its results are expected to be less affected by natural recombination between LMV isolates, and it allows sensitive detection of LMV-Most in situations of single as well as mixed contamination. (C) 2004 Elsevier B.V. All rights reserved.

Molecular mapping of the viral determinants of systemic wilting induced by a Lettuce mosaic virus (LMV) isolate in some lettuce cultivars

The isolate AF199 of Lettuce mosaic virus (LMV, genus Potyvirus) causes local lesions followed by systemic wilting and plant death in the lettuce cultivars Ithaca and Vanguard 75. Analysis of the phenotype of virus chimeras revealed that a region within the PI protein coding region (nucleotides 112-386 in the viral genome) and/or another one within the CI protein coding region (nucleoticles 5496-5855) are sufficient together to cause the lethal wilting in Ithaca, but not in Vanguard 75. This indicates that the determinants of this particular symptom are different in these two lettuce cultivars. The wilting phenotype was not directly correlated with differences in the deduced amino acid sequence of these two regions. Furthermore, transient expression of the LMV-AF 199 proteins, separately or in combination, did not induce local necrosis or any other visible reaction in the plants. Together, these results Suggest that the systemic wilting reaction might be Clue to RNA rather than protein sequences. (c) 2004 Elsevier B.V. All rights reserved.

Eucalyptus ESTs involved in mechanisms against plant pathogens and environmental stresses

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Quantitative control of Lettuce mosaic virus fitness and host defence inhibition by P1-HCPro

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Characterization of Paracoccidioides brasiliensis PbDfg5p, a cell-wall protein implicated in filamentous growth

The dimorphic fungus Paracoccidioides brasiliensis is the causative agent of the most frequent systemic mycosis in Latin America. In humans, infection starts by inhalation of fungal propagules, which reach the pulmonary epithelium and differentiate into the yeast parasitic phase. Here we describe the characterization of a Dfg5p ((d) under bar efective for (f) under bar ilamentous (g) under bar rowth) homologue of P. brasiliensis, a predictable cell wall protein, first identified in Saccharomyces cerevisiae. The protein, the cDNA and genomic sequences were analysed. The cloned cDNA was expressed in Escherichia coli and the purified rPbDfg5p was used to obtain polyclonal antibodies. Immunoelectron microscopy and biochemical studies demonstrated the presence of PbDfg5p in the fungal cell wall. Enzymatic treatments identified PbDfg5p as a beta-glucan linked protein that undergoes N -glycosylation. The rPbDfg5p bound to extracellular matrix components, indicating that those interactions could be important for initial steps leading to P. brasiliensis attachment and colonization of host tissues. The P. brasiliensis dfg5 nucleotide and deduced protein, PbDfg5p, sequences reported in this paper had been submitted to the GenBank database under Accession Nos AY307855 (cDNA) and DQ534495 (genomic). Copyright (C) 2007 John Wiley & Sons, Ltd.

Immobilization of streptavidin in sol-gel films: Application on the diagnosis of hepatitis C virus

Recent advances have accelerated the development of biosensors for the analysis of specific gene sequences. In this kind of biosensor, a DNA probe is immobilized on a transducer and the hybridization with the target DNA is monitored by suitable methodology. In the present work, the streptavidin (STA) was encapsulated in thin films siloxane-poly(propylene oxide) hybrids prepared by sol-gel method and deposited on the graphite electrode surface by dip-coating process. Biotinylated 18-mer probes were immobilized through STA and a novel amperometric DNA biosensor for the detection and genotyping of the hepatitis C virus (genotypes 1, 2A/C, 2B and 3) is described. The HCV RNA from serum was submitted to reverse transcriptase-linked polymerase chain reaction (RT-PCR) and biotin-labeled cDNA was obtained. Thus, the cDNA was hybridized to the target-specific oligonucleotide probe immobilized on the graphite electrode surface and following the avidin-peroxidase conjugate was added. The enzymatic response was investigated by constant potential amperometry at -0.45 V versus Ag/AgCl using H2O2 and KI solutions. HCV RNA negative and positive controls and positive samples of sera patients were analyzed and the results were compared to commercial kit. The proposed methodology appeared to be suitable and convenient tool for streptavidin immobilization and diagnose of HCV disease. (c) 2006 Elsevier B.V. All rights reserved.

The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome

open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription-PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning.