979 resultados para Platinum single crystals electrodes
Resumo:
We present a new method for lysis of single cells in continuous flow, where cells are sequentially trapped, lysed and released in an automatic process. Using optimized frequencies, dielectrophoretic trapping allows exposing cells in a reproducible way to high electrical fields for long durations, thereby giving good control on the lysis parameters. In situ evaluation of cytosol extraction on single cells has been studied for Chinese hamster ovary (CHO) cells through out-diffusion of fluorescent molecules for different voltage amplitudes. A diffusion model is proposed to correlate this out-diffusion to the total area of the created pores, which is dependent on the potential drop across the cell membrane and enables evaluation of the total pore area in the membrane. The dielectrophoretic trapping is no longer effective after lysis because of the reduced conductivity inside the cells, leading to cell release. The trapping time is linked to the time required for cytosol extraction and can thus provide additional validation of the effective cytosol extraction for non-fluorescent cells. Furthermore, the application of one single voltage for both trapping and lysis provides a fully automatic process including cell trapping, lysis, and release, allowing operating the device in continuous flow without human intervention.
Resumo:
The Bi2Sr2CaCu20g single crystal with a superconducting transition temperature equal to 90 ± 2 K was prepared. The irreversibility line of the single crystal for a mgnetic field direction along the c-axis and T* in the ab-plane was determined. The reduced temperature (l - T ) is proportional to H 1.1 for fields below 004 T and proportional to HO.09 for fields above 0.4 T. The zero temperature upper critical field Hc2(0) and coherence length ~ (0) were determined from the magnetization meaurements to be H-lC2=35.9T , H//C2=31.2T, ~c(0)=35.0 A, and ~ab(0)=32.5A,and from the magnetoresistance measurements to be H-lc2 = 134.6T , H//C2=55.5T '~c(0)=38.1 A, and ~ab(0)=2404 A for both directions of the applied magnetic field. The results obtained for Hc2(0) and ~(O) are not reliable due to the rounding that the single crystal exhibits in the magnetization and magnetoresistance curves. The magnetization relaxation of the single crystal was investigated, and was found to be logarithmic in time, and the relaxation rate increases with temperature up to 50 -60 K, then decreases at higher temperatures.
Resumo:
Palladium and platinum complexes of pyridoxamine, pyridoxine and pyridoxal have been prepared. The structures of the complexes PtCI2PM.H20, trans-PdC12 (PN)2 and [PLH+ ]2[PtC16] 2- ,H20 have been determined by use of single crystal x-ray studies. The compounds PdC12PH, trans-PdC12 (PN) 2 , cis-PdCI2 (PN)2 and cis PdC12 (PL)2 were also studied by use of carbon-13 nmr spectroscopy. All the complexes have also been characterised by use of infrared spectral studies. In the complexes, PtCI2PM.H20 and PdC12PM, the ligand pyridoxamine is chela ted to the metal through the aminomethyl nitrogen and the phenolate oxygen atoms whereas in the complexes, trans-PdCI2 (PN)2' cis-PdCI2 (PN)2 and cis-PdC12 (PL)2 the vitamin B6 ligands are coordinated to the metal through the pyridine ring nitrogen. The compounds [PLH+ ]2[PtCI6] 2- .H20 and [PMH2] 2+ [PdCI4] 2- .H20have no direct metal-ligand bonding, In all the complexes, the metal maintains a square planar coordination except in [PLH +] 2[PtCI6] 2- ,H20 where the metal is octahedrally coordinated. PH pyridoxamine [PMH ] 2+ = diprotonated pyridoxamine 2 PN = pyridoxine PL pyridoxal PLH+ protonated pyridoxal
Resumo:
he phenomenon of single beam mirage effect, otherwise known as photothermal deflection (PTD) effect using a He–Ne laser beam has been employed to detect phase transitions in some liquid crystals. It has been observed that anomalous changes in amplitude occur in the PTD signal level near the transition temperature. The experimental details and the results of measurements made in liquid crystals E8, M21 and M24 are given in this paper.
Resumo:
Electrochemical sensors are increasingly being investigated to perform measurements for single or multiple analytes. Demanded by modern medical diagnosis, advances in microfabrication technology have led to the development of fast, sensitive and selective electrochemical sensors for drug analysis. Electrochemical sensors for the measurement of analytes of interest in clinical chemistry are ideally suited for these applications, due to their high sensitivity and selectivity, simple-to-operate, rapid response time and low-cost. As part of the present investigations eight voltammetric sensors have been fabricated for six drugs such as PAM Chloride, Tamsulosin Hydrochloride, Hesperidin Methyl Chalcone, Guaiphenesin, Cephalexin and Amoxicillin trihydrate. The modification techniques adopted as part of the present work include multiwalled carbon nanotube (MWNT) based modifications, electropolymerization, gold nanoparticle (AuNP) based modifications and platinum nanoparticle (PtNP) based modifications. The thesis is divided into nine chapters
Resumo:
Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.
Resumo:
Quartz crystal microbalance (QCM) measurements of the formation of a 4-aminothiophenol (4-ATP)self-assembled monolayer (SAM) at a gold electrode showed that a surface coverage of 118 ng cm(-2) was obtained after a 3 h exposure period, indicating that good surface coverage was achieved. Cyclic voltammetry of the ferricyanide redox couple across this SAM modified surface produced similar results to those of a bare electrode; however, the electroreduction of oxygen was found to be impaired. The 4-ATP SAM layer was not stable to repeated electrochemical oxidation and reduction; it is believed that the 4-ATP SAM layer was first converted to a 4'-mercapto-N-phenylquinone diimine (NPQD) layer followed by subsequent formation of a 4'-mercapto-N-phenylquinone monoimine (NPQM) layer. We also report a quartz crystal microbalance study of the attachment of platinum nanoparticles to such SAM modified electrodes. We show that five times the amount of platinum nanoparticles can be attached to a 4-ATP modified electrode surface (observed frequency change - 187 Hz) compared with an NPQD modified electrode surface (observed frequency change -35 Hz). The presence of the platinum particles was confirmed electrochemically by their surface electrochemical properties, which were different from those of the underlying gold electrode. It is believed that this is the first time that such direct evidence of electrochemical communication between platinum nanoparticles and a SAM modified electrode surface has been obtained. It was also shown to be possible to build up multilayer SAM/nanoparticle modified surfaces while maintaining efficient electrochemical communication. Up to three SAM/nanoparticle sandwich layers were constructed.
Resumo:
The electrochemistry of nanostructured electrodes is investigated using hydrodynamic modulated voltammetry (HMV). Here a liquid crystal templating process is used to produce a platinum modified electrode with a relatively high surface area (Roughness factor, Rf = 42.4). The electroreduction of molecular oxygen at a nanostructured platinum surface is used to demonstrate the ability of HMV to discriminate between Faradaic and non-Faradaic electrode reactions. The HMV approach shows that the reduction of molecular oxygen shows considerable hysteresis correlating with the formation and stripping of oxide species at the platinum surface. Without the HMV analysis it is difficult to discern the same detail under the conditions employed. In addition the detection limit of the apparatus is explored and shown, under ideal conditions, to be of the order of 45 nmol dm(-3) employing [Fe(CN)(6)](4-) as a test species. (C) 2009 Elsevier B.V. All rights reserved.
Resumo:
The reaction of the redox-active ligand, Hpyramol (4-methyl-2-N-(2-pyridylmethyl)aminophenol) with K2PtCl4 yields monofunctional square-planar [Pt(pyrimol)Cl], PtL-Cl, which was structurally characterised by single-crystal X-ray diffraction and NMR spectroscopy. This compound unexpectedly cleaves supercoiled double-stranded DNA stoichiometrically and oxidatively, in a non-specific manner without any external reductant added, under physiological conditions. Spectro-electrochemical investigations of PtL-Cl were carried out in comparison with the analogue CuL-Cl as a reference compound. The results support a phenolate oxidation, generating a phenoxyl radical responsible for the ligand-based DNA cleavage property of the title compounds. Time-dependent in vitro cytotoxicity assays were performed with both PtL-Cl and CuL-Cl in various cancer cell lines. The compound CuL-Cl overcomes cisplatin-resistance in ovarian carcinoma and mouse leukaemia cell lines, with additional activity in some other cells. The platinum analogue, PtL-Cl also inhibits cell-proliferation selectively. Additionally, cellular-uptake studies performed for both compounds in ovarian carcinoma cell lines showed that significant amounts of Pt and Cu were accumulated in the A2780 and A2780R cancer cells. The conformational and structural changes induced by PtL-Cl and CuL-Cl on calf thymus DNA and phi X174 supercoiled phage DNA at ambient conditions were followed by electrophoretic mobility assay and circular dichroism spectroscopy. The compounds induce extensive DNA degradation and unwinding, along with formation of a monoadduct at the DNA minor groove. Thus, hybrid effects of metal-centre variation, multiple DNA-binding modes and ligand-based redox activity towards cancer cell-growth inhibition have been demonstrated. Finally, reactions of PtL-Cl with DNA model bases (9-Ethylguanine and 5'-GMP) followed by NMR and MS showed slow binding at Guanine-N7 and for the double stranded self complimentary oligonucleotide d(GTCGAC)(2) in the minor groove.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The molecular structure of trans-[PtCl(CCPh)(PEt2Ph)2] has been determined by X-ray diffraction methods. The crystals are monoclinic, space group P21, with a= 12.359(3), b= 13.015(3), c= 9.031(2)Å, β= 101.65(2)°, and Z= 2. The structure has been solved by the heavy-atom method and refined by full-matrix least squares to R 0.046 for 1 877 diffractometric intensity data. The crystals contain discrete molecules in which the platinum coordination is square planar. The phenylethynyl group is non-linear, with a Pt–CC angle of 163(2)°. Selected bond lengths are Pt–Cl 2.407(5) and Pt–C 1.98(2)Å. The structural trans influences of CCPh, CHCH2, and CH2SiMe3 ligands in platinum(II) complexes are compared; there is only a small dependence on hybridization at the ligating carbon atom.
Resumo:
The molecular structure of trans-[PtCl(CHCH2)(PEt2Ph)2] has been determined by X-ray diffraction methods. The crystals are orthorhombic, space group Pbcn, with a= 10.686(2), b= 13.832(4), c= 16.129(4)Å, and Z= 4. The structure has been solved by the heavy-atom method and refined by full-matrix least squares to R 0.044 for 1 420 diffractometric intensity data. The crystals contain discrete molecules in which the platinum co-ordination is square planar. The Pt–Cl bond vector coincides with a crystallographic diad axis about which the atoms of the vinyl group are disordered. Selected bond lengths (Å) are Pt–Cl 2.398(4), Pt–P 2.295(3), and Pt–C 2.03(2). The Pt–CC angle is 127(2)°. From a survey of the available structural data it is concluded that there is little, if any, back donation from platinum to carbon in platinum–alkenyl linkages.
Resumo:
The compounds trans-[PtBr{C(C10H15)CH2}(PEt3)2](1)(C10H15= adamant-1-yl), trans-[MBr{C(C10H7)CMe2}(PEt3)2][M = Pd (2) or Pt (3); C10H7= naphth-1-yl], and trans-[MBr{C(Ph)CMe2}(PEt3)2][M = Pd (4) or Pt (5)] have been prepared from Grignard [for (2) and (3)] or lithium reagents [for (1), (4), and (5)] and appropriate dichlorobis(phosphine)metal derivatives. Full single-crystal X-ray data are reported for (1) and (3), and reveal unusually long Pt–C(sp2) bonds. Insertion reactions into these M–C bonds occur with MeNC [for (1), (3), and (5)], and with CO [for (1) and (3)]; the latter, the first reported insertion into a Pt–C(sp2) bond, occurs under mild conditions as expected for the abnormally long M–C bonds.
Resumo:
We report here the patterning of primary rat neurons and astrocytes from the postnatal hippocampus on ultra-thin parylene-C deposited on a silicon dioxide substrate, following observations of neuronal, astrocytic and nuclear coverage on strips of different lengths, widths and thicknesses. Neuronal and glial growth was characterized ‘on’, ‘adjacent to’ and ‘away from’ the parylene strips. In addition, the article reports how the same material combination can be used to isolate single cells along thin tracks of parylene-C. This is demonstrated with a series of high magnification images of the experimental observations for varying parylene strip widths and thicknesses. Thus, the findings demonstrate the possibility to culture cells on ultra-thin layers of parylene-C and localize single cells on thin strips. Such work is of interest and significance to the Neuroengineering and Multi-Electrode Array (MEA) communities, as it provides an alternative insulating material in the fabrication of embedded micro-electrodes, which can be used to facilitate single cell stimulation and recording in capacitive coupling mode.
Resumo:
Crystal engineering principles were used to design three new co-crystals of paracetamol. A variety of potential cocrystal formers were initially identified from a search of the Cambridge Structural Database for molecules with complementary hydrogen-bond forming functionalities. Subsequent screening by powder X-ray diffraction of the products of the reaction of this library of molecules with paracetamol led to the discovery of new binary crystalline phases of paracetamol with trans-1,4- diaminocyclohexane (1); trans-1,4-di(4-pyridyl)ethylene (2); and 1,2-bis(4-pyridyl)ethane (3). The co-crystals were characterized by IR spectroscopy, differential scanning calorimetry, and 1H NMR spectroscopy. Single crystal X-ray structure analysis reveals that in all three co-crystals the co-crystal formers (CCF) are hydrogen bonded to the paracetamol molecules through O−H···N interactions. In co-crystals (1) and (2) the CCFs are interleaved between the chains of paracetamol molecules, while in co-crystal (3) there is an additional N−H···N hydrogen bond between the two components. A hierarchy of hydrogen bond formation is observed in which the best donor in the system, the phenolic O−H group of paracetamol, is preferentially hydrogen bonded to the best acceptor, the basic nitrogen atom of the co-crystal former. The geometric aspects of the hydrogen bonds in co-crystals 1−3 are discussed in terms of their electrostatic and charge-transfer components.