Miscibility studies in poly(methyl vinyl ether)/hydroxypropylcellulose binary system in aqueous solutions and solid state

The phase separation behaviour in aqueous mixtures of poly(methyl vinyl ether) and hydroxypropylcellulose has been studied by cloud points method and viscometric measurements. The miscibility of these blends in solid state has been assessed by infrared spectroscopy; methanol vapours sorption experiments and scanning electron microscopy. The values of Gibbs energy of mixing of the polymers and their blends with methanol as well as between each other were calculated. It was found that in solid state the polymers can interact with methanol very well but the polymer-polymer interactions are unfavourable. Although in aqueous solutions the polymers exhibit some intermolecular interactions their solid blends are not completely miscible. (C) 2005 Elsevier Ltd. All rights reserved.

Interpolymer complexes of hydroxy-propylmethylcellulose with polycarboxylic acids in aqueous solutions

The interactions between hydroxypropylmethylcellulose (HPMC) and poly(acrylic acid) (PAA) as well as poly(methacrylic acid) (PMMA) resulting in formation of hydrophobic interpolymer complexes (IPC) via hydrogen bonding have been studied in aqueous solutions in acidic medium. The formation of IPC of two different compositions (2:1 and 4:1) has been detected for complexes of PAA and HPMC. The critical pH values for complexation of HPMC with PAA and PMAA were determined by the turbidimetric method. It was found that PAA shows the lower complexation ability compared to PMAA due to the more hydrophobic nature of the latter polyacid. The temperature-induced phase separation in HPMC-PAA solution mixtures depends greatly on the components ratio and PAA molecular weight. The complexation ability of hydroxypropylmethylcellulose with respect to poly(acrylic acid) was found to be similar to the complexation ability of methylcellulose, lower than that of hydroxypropylcellulose and higher than that of hydroxyethylcellulose. (c) 2006 Society of Chemical Industry.

The geometry of optimal control solutions on some six dimensional lie groups

This paper examines optimal solutions of control systems with drift defined on the orthonormal frame bundle of particular Riemannian manifolds of constant curvature. The manifolds considered here are the space forms Euclidean space E-3, the spheres S-3 and the hyperboloids H-3 with the corresponding frame bundles equal to the Euclidean group of motions SE(3), the rotation group SO(4) and the Lorentz group SO(1,3). The optimal controls of these systems are solved explicitly in terms of elliptic functions. In this paper, a geometric interpretation of the extremal solutions is given with particular emphasis to a singularity in the explicit solutions. Using a reduced form of the Casimir functions the geometry of these solutions are illustrated.

Approximate Riemann solutions of the two-dimensional shallow-water equations

A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.

Similarity solutions of the shallow water equations

A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Solutions of a two-dimensional dam-break problem

Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.

Similarity solutions for multicomponent flows

A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

The implications of service-dominant logic and integrated solutions on the sales function

This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.

Stability of solutions of linear difference equations with periodic coefficients

This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.

Biomimetic triblock copolymer membranes: from aqueous solutions to solid supports

In the present paper, we studied the preparation of biomimetic triblock copolymer (ABA) membranes in aqueous solution and their deposition into solid supports. The self-assembly structures of the ABA in aqueous solution was investigated by using optical microscopy, dynamic light scattering, electron microscopy (EM) and SAXS. Spherical and tubular polymersomes were found at the highest concentrations investigated. The mechanism of deposition on solid supports (mica and glass) was elucidated by using atomic force microscopy (AFM). The deposition results in the formation of a uniform defect-free membrane at suitable polymer concentrations.

A simple fluid cell for the study of aqueous solutions using THz time-domain spectroscopy

We describe a fluid cell for the measurement of aqueous solutions of biomolecules adapted particularly for the requirements of THz time-domain spectroscopy. The design is simple, requires small-volume samples, avoids cross-contamination and is inexpensive.

A moving-mesh finite element method and its application to the numerical solution of phase-change problems

A distributed Lagrangian moving-mesh finite element method is applied to problems involving changes of phase. The algorithm uses a distributed conservation principle to determine nodal mesh velocities, which are then used to move the nodes. The nodal values are obtained from an ALE (Arbitrary Lagrangian-Eulerian) equation, which represents a generalization of the original algorithm presented in Applied Numerical Mathematics, 54:450--469 (2005). Having described the details of the generalized algorithm it is validated on two test cases from the original paper and is then applied to one-phase and, for the first time, two-phase Stefan problems in one and two space dimensions, paying particular attention to the implementation of the interface boundary conditions. Results are presented to demonstrate the accuracy and the effectiveness of the method, including comparisons against analytical solutions where available.