Effects of gamma-radiation on cell growth, cycle arrest, death, and superoxide dismutase expression by DU 145 human prostate cancer cells

Gamma-irradiation (gamma-IR) is extensively used in the treatment of hormone-resistant prostate carcinoma. The objective of the present study was to investigate the effects of 60Co gamma-IR on the growth, cell cycle arrest and cell death of the human prostate cancer cell line DU 145. The viability of DU 145 cells was measured by the Trypan blue exclusion assay and the 3(4,5-dimethylthiazol-2-yl)-2,5,diphenyltetrazolium bromide test. Bromodeoxyuridine incorporation was used for the determination of cell proliferation. Cell cycle arrest and cell death were analyzed by flow cytometry. Superoxide dismutase (SOD), specifically CuZnSOD and MnSOD protein expression, after 10 Gy gamma-IR, was determined by Western immunoblotting analysis. gamma-IR treatment had a significant (P < 0.001) antiproliferative and cytotoxic effect on DU 145 cells. Both effects were time and dose dependent. Also, the dose of gamma-IR which inhibited DNA synthesis and cell proliferation by 50% was 9.7 Gy. Furthermore, gamma-IR induced cell cycle arrest in the G2/M phase and the percentage of cells in the G2/M phase was increased from 15% (control) to 49% (IR cells), with a nonsignificant induction of apoptosis. Treatment with 10 Gy gamma-IR for 24, 48, and 72 h stimulated CuZnSOD and MnSOD protein expression in a time-dependent manner, approximately by 3- to 3.5-fold. These data suggest that CuZnSOD and MnSOD enzymes may play an important role in the gamma-IR-induced changes in DU 145 cell growth, cell cycle arrest and cell death.

The role of IFN-gamma and IL-4 in gastric mucosa inflammation associated with Helicobacter heilmannii type 1 infection

Although Helicobacter heilmannii infection is less common than H. pylori infection in humans, it is considered to be of medical importance because of its association with gastritis, gastric ulcer, carcinoma, and mucosa-associated lymphoid tissue lymphoma of the stomach. However, there have been no studies evaluating the role of the Th cell response in H. heilmannii gastric infection. We evaluated the participation of pro-inflammatory and anti-inflammatory cytokines, IFN-gamma and IL-4, in H. heilmannii gastric infection in genetically IFN-gamma- or IL-4-deficient mice. The serum IFN-gamma and IL-4 concentrations were determined by ELISA. The gastric polymorphonuclear infiltrate was higher (P = 0.007) in H. heilmannii-positive than in H. heilmannii-negative wild-type (WT) C57BL/6 mice, whereas no significant inflammation was demonstrable in the stomach of H. heilmannii-positive IFN-gamma-/- C57BL/6 mice. The degree of gastric inflammatory cells, especially in oxyntic mucosa, was also higher (P = 0.007) in infected IL-4-/- than in WT BALB/c mice. Serum IFN-gamma levels were significantly higher in IL-4-/- than in WT BALB/c mice, independently of H. heilmannii-positive or -negative status. Although no difference in serum IFN-gamma levels was seen between H. heilmannii-positive (11.3 ± 3.07 pg/mL, mean ± SD) and -negative (11.07 ± 3.5 pg/mL) WT BALB/c mice, in the group of IL-4-/- animals, the serum concentration of IFN-g was significantly higher in the infected ones (38.16 ± 10.5 pg/mL, P = 0.04). In contrast, serum IL-4 levels were significantly decreased in H. heilmannii-positive (N = 10) WT BALB/c animals compared to the negative (N = 10) animals. In conclusion, H. heilmannii infection induces a predominantly Th1 immune response, with IFN-gamma playing a central role in gastric inflammation.

The anti-IRBP IgG1 and IgG2a response does not correlate with susceptibility to experimental autoimmune uveitis

Susceptibility to experimental autoimmune uveitis (EAU) in inbred mice has been associated with a dominant Th1 response. Elevated anti-inter-photoreceptor retinoid-binding protein (anti-IRBP) IgG2a/IgG1 antibody ratios have been implicated as candidate markers to predict disease severity. In the present study, both the anti-IRBP antibody isotype and severity of EAU phenotypes were examined in 4 non-isogenic genetically selected mouse lines to determine if they can be used as general markers of disease. Mice between 8 and 12 weeks old selected for high (H III) or low (L III) antibody response and for maximum (AIR MAX) or minimum (AIR MIN) acute inflammatory reaction (AIR) were immunized with IRBP. Each experiment was performed with at least 5 mice per group. EAU was evaluated by histopathology 21 days after immunization and the minimal criterion was inflammatory cell infiltration of the ciliary body, choroid and retina. Serum IgG1- and IgG2a-specific antibodies were determined by ELISA. EAU was graded by histological examination of the enucleated eyes. The incidence of EAU was lower in AIR MIN mice whereas in the other strains approximately 40% of the animals developed the disease. Low responder animals did not produce anti-IRBP IgG2a antibodies or interferon-gamma. No correlation was observed between susceptibility to EAU and anti-IRBP isotype profiles. Susceptibility to EAU is related to the intrinsic capacity to mount higher inflammatory reactions and increased production of anti-IRBP IgG2a isotype is not necessarily a marker of this immunologic profile.

Genetic polymorphisms in vitamin D receptor, vitamin D-binding protein, Toll-like receptor 2, nitric oxide synthase 2, and interferon-γ genes and its association with susceptibility to tuberculosis

Mycobacterium tuberculosis kills more people than any other single pathogen, with an estimated one-third of the world's population being infected. Among those infected, only 10% will develop the disease. There are several demonstrations that susceptibility to tuberculosis is linked to host genetic factors in twins, family and associated-based case control studies. In the past years, there has been dramatic improvement in our understanding of the role of innate and adaptive immunity in the human host defense to tuberculosis. To date, attention has been paid to the role of genetic host and parasitic factors in tuberculosis pathogenesis mainly regarding innate and adaptive immune responses and their complex interactions. Many studies have focused on the candidate genes for tuberculosis susceptibility ranging from those expressed in several cells from the innate or adaptive immune system such as Toll-like receptors, cytokines (TNF-α, TGF-β, IFN-γ, IL-1b, IL-1RA, IL-12, IL-10), nitric oxide synthase and vitamin D, both nuclear receptors and their carrier, the vitamin D-binding protein (VDBP). The identification of possible genes that can promote resistance or susceptibility to tuberculosis could be the first step to understanding disease pathogenesis and can help to identify new tools for treatment and vaccine development. Thus, in this mini-review, we summarize the current state of investigation on some of the genetic determinants, such as the candidate polymorphisms of vitamin D, VDBP, Toll-like receptor, nitric oxide synthase 2 and interferon-γ genes, to generate resistance or susceptibility to M. tuberculosis infection.

Promoter region sequence differences in the A and G gamma globin genes of Brazilian sickle cell anemia patients

Fetal hemoglobin (HbF), encoded by the HBG2 and HBG1 genes, is the best-known genetic modulator of sickle cell anemia, varying dramatically in concentration in the blood of these patients. This variation is partially associated with polymorphisms located in the promoter region of the HBG2 and HBG1 genes. In order to explore known and unknown polymorphisms in these genes, the sequences of their promoter regions were screened in sickle cell anemia patients and correlated with both their HbF levels and their βS-globin haplotypes. Additionally, the sequences were compared with genes from 2 healthy groups, a reference one (N = 104) and an Afro-descendant one (N = 98), to identify polymorphisms linked to the ethnic background.The reference group was composed by healthy individuals from the general population. Four polymorphisms were identified in the promoter region of HBG2 and 8 in the promoter region of HBG1 among the studied groups. Four novel single nucleotide polymorphisms (SNP) located at positions -324, -317, -309 and -307 were identified in the reference group. A deletion located between -396 and -391 in the HBG2 promoter region and the SNP -271 C→T in the HBG1 promoter region were associated with the Central African Republic βS-globin haplotype. In contrast, the -369 C→G and 309 A→G SNPs in the HBG2 promoter region were correlated to the Benin haplotype. The polymorphisms -396_-391 del HBG2, -369 SNP HBG2 and -271 SNP HBG1 correlated with HbF levels. Hence, we suggest an important role of HBG2 and HBG1 gene polymorphisms on the HbF synthesis.

A clinical gamma camera-based pinhole collimated system for high resolution small animal SPECT imaging

The main objective of the present study was to upgrade a clinical gamma camera to obtain high resolution tomographic images of small animal organs. The system is based on a clinical gamma camera to which we have adapted a special-purpose pinhole collimator and a device for positioning and rotating the target based on a computer-controlled step motor. We developed a software tool to reconstruct the target’s three-dimensional distribution of emission from a set of planar projections, based on the maximum likelihood algorithm. We present details on the hardware and software implementation. We imaged phantoms and heart and kidneys of rats. When using pinhole collimators, the spatial resolution and sensitivity of the imaging system depend on parameters such as the detector-to-collimator and detector-to-target distances and pinhole diameter. In this study, we reached an object voxel size of 0.6 mm and spatial resolution better than 2.4 and 1.7 mm full width at half maximum when 1.5- and 1.0-mm diameter pinholes were used, respectively. Appropriate sensitivity to study the target of interest was attained in both cases. Additionally, we show that as few as 12 projections are sufficient to attain good quality reconstructions, a result that implies a significant reduction of acquisition time and opens the possibility for radiotracer dynamic studies. In conclusion, a high resolution single photon emission computed tomography (SPECT) system was developed using a commercial clinical gamma camera, allowing the acquisition of detailed volumetric images of small animal organs. This type of system has important implications for research areas such as Cardiology, Neurology or Oncology.

Plasma cytokine response, lipid peroxidation and NF-κB activation in skeletal muscle following maximum progressive swimming

Our objective was to determine lipid peroxidation and nuclear factor-κB (NF-κB) activation in skeletal muscle and the plasma cytokine profile following maximum progressive swimming. Adult male Swiss mice (N = 15) adapted to the aquatic environment were randomly divided into three groups: immediately after exercise (EX1), 3 h after exercise (EX2) and control. Animals from the exercising groups swam until exhaustion, with an initial workload of 2% of body mass attached to the tail. Control mice did not perform any exercise but were kept immersed in water for 20 min. Maximum swimming led to reactive oxygen species (ROS) generation in skeletal muscle, as indicated by increased thiobarbituric acid reactive species (TBARS) levels (4062.67 ±1487.10 vs 19,072.48 ± 8738.16 nmol malondialdehyde (MDA)/mg protein, control vs EX1). Exercise also promoted NF-κB activation in soleus muscle. Cytokine secretion following exercise was marked by increased plasma interleukin-6 (IL-6) levels 3 h post-exercise (P < 0.05). Interleukin-10 (IL-10) levels were reduced following exercise and remained reduced 3 h post-exercise (P < 0.05). Plasma levels of other cytokines investigated, monocyte chemotactic protein-1 (MCP-1), tumor necrosis factor-alpha (TNF-α), interferon-gamma (IFN-γ) and interleukin-12 (IL-12), were not altered by exercise. The present findings showed that maximum swimming, as well as other exercise models, led to lipid peroxidation and NF-κB activation in skeletal muscle and increased plasma IL-6 levels. The plasma cytokine response was also marked by reduced IL-10 levels. These results were attributed to exercise type and intensity.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Estudo do efeito da irradiação gamma (60CO) na qualidade da cachaça e no tonel de envelhecimento

O processo de envelhecimento ou maturação das bebidas proporciona uma melhora nas características sensoriais da cachaça, tornando-a de qualidade superior e de maior valor econômico. O método tradicional de maturação de bebidas é sua interação com madeiras, sendo que a irradiação pode acelerar este processo de envelhecimento. A cachaça e os tonéis de carvalho de 20 L de capacidade foram submetidos à irradiação gama (150 Gy). Análises físico-químicas e cromatográficas foram realizadas periodicamente ao longo de 390 dias do período de envelhecimento da bebida. A irradiação da cachaça e do tonel não alterou a maioria dos componentes voláteis do coeficiente de congêneres como acidez volátil, ésteres, álcoois superiores e furfural durante os 390 dias. Há evidências, entretanto, de que os parâmetros de alguns componentes como aldeídos, taninos, cor e teor de cobre são de alguma forma influenciados, resultando em aceleração parcial do processo de maturação ou envelhecimento. Ao final do período de envelhecimento, foi feita uma análise sensorial com 30 provadores não treinados. A aceleração do processo de envelhecimento foi confirmada pela avaliação sensorial, e a cachaça e/ou tonel irradiados receberam maior indicação de aprovação em todos os parâmetros analisados (aroma, sabor e aparência).

Physicochemical and microbiological quality of raspberries (Rubus idaeus) treated with different doses of gamma irradiation

This study was conducted to evaluate the physicochemical and microbiological characteristics of raspberries exposed to different radiation doses. The fruits were harvested in the city of Campestre, MG, packed in polyethylene bags, and transported to the Federal University of Lavras (UFLA), where they were separated into 4 lots. Irradiation was performed at the Center for Development of Nuclear Technology in Belo Horizonte, MG. The doses used were 0 (control), 0.5, 1.0, and 2.0 kGy. After irradiation, the fruits were transported back to UFLA and stored at 1 ºC and 95% relative humidity (RH) for 12 days. The physicochemical analyses for mass loss, total soluble solids, titratable acidity, pH, total soluble sugars, total soluble pectin, firmness, vitamin C content, total antioxidant activity, and total phenolic, and the microbiological assays (coliform at 35 and 45 ºC, psychrotrophic and filamentous fungi and yeasts) were performed after 0, 3, 6, 9, and 12 days of storage. Lower loss of mass and filamentous fungi and yeast count were observed in the irradiated fruits, and 2 kGy was determined as the most effective dose for microbial control, but this irradiation dose also resulted in increased loss of fruit firmness.

Alpha-tocopherol and gamma-tocopherol concentration in vegetable oils

Vegetable oils are the richest dietary sources of vitamin E. Vitamin E determination levels in foods are of great importance to adjust the ingestion of nutrients by the population. The purpose of this paper is to determine the concentration of alpha-tocopherol and gamma-tocopherol in vegetable oils and compare the alpha-tocopherol value to the nutritional requirement of vitamin E. The analysis was performed using High Performance Liquid Chromatography. The values expressed as mg/kg for alpha and gamma-tocopherol were, respectively, 120.3±4.2 and 122.0±7.9 in canola oil; 432.3±86.6 and 92.3±9.5 in sunflower oil; 173.0±82.3 and 259.7±43.8 in corn oil; 71.3±6.4 and 273.3±11.1 in soybean oil. A significant difference was encountered between the alpha-tocopherol concentrations in vegetable oils. Similar results were found for gamma-tocopherol, except for corn and soybean oils. It was concluded that the soybean oil was not considered a source of vitamin E. The canola and corn oils were considered sources, and the sunflower oil was considered an excellent source.

Charting developmental EEG gamma changes in the auditory modality /

The oscillation of neuronal circuits reflected in the EEG gamma frequency may be fundamental to the perceptual process referred to as binding (the integration of various thoughts and perceptions into a coherent picture). The aim of our study was to expand our knowledge of the developmental course ofEEG gamma in the auditory modality. 2 We investigated EEG 40 Hz gamma band responses (35.2 to 43.0 Hz) using an auditory novelty oddball paradigm alone and with a visual-number-series distracter task in 208 participants as a function of age (7 years to adult) at 9 sites across the sagital and lateral axes (F3, Fz, F4, C3, Cz, C4, P3, Pz, P4). Gamma responses were operationally defined as change in power or a change in phase synchrony level from baseline within two time windows. The evoked gamma response was defined as a significant change from baseline occurring between 0 to 150 ms after stimulus onset; the induced gamma response was measured from 250 to 750 ms after stimulus onset. A significant evoked gamma band response was found when measuring changes in both power and phase synchrony. The increase in both measures was maximal at frontal regions. Decreases in both measures were found when participants were distracted by a secondary task. For neither measure were developmental effects noted. However, evoked gamma power was significantly enhanced with the presentation of a novel stimulus, especially at the right frontal site (F4); frontal evoked gamma phase synchrony also showed enhancement for novel stimuli but only for our two oldest age groups (16-18 year olds and adults). Induced gamma band responses also varied with task-dependent cognitive stimulus properties. In the induced gamma power response in all age groups, target stimuli generated the highest power values at the parietal region, while the novel stimuli were always below baseline. Target stimuli increased induced synchrony in all regions for all participants, but the novel stimulus selectively affected participants dependent on their age and gender. Adult participants, for example, exhibited a reduction in gamma power, but an increase in synchrony to the novel stimulus within the same region. Induced gamma synchrony was more sensitive to the gender of the participant than was induced gamma power. While induced gamma power produced little effects of age, gamma synchrony did have age effects. These results confirm that the perceptual process which regulates gamma power is distinct from that which governs the synchronization for neuronal firing, and both gamma power and synchrony are important factors to be considered for the "binding" hypothesis. However, there is surprisingly little effect of age on the absolute levels of or distribution of EEG gamma in the age range investigated.

Does Gamma-aminobutyric acid function as a plant resistance mechanism against phytophagous insect activity? /

Gamma-aminobutyric acid (GAB A) is a ubiquitous non-protein amino acid synthesized via the decarboxylation of L-glutamate in a reaction catalyzed by the cytosolic enzyme L-glutamate decarboxylase (GAD). In animals it functions as an inhibitory neurotransmitter. In plants it accumulates rapidly in response to various stresses, but its function remains unclear. The hypothesis that GABA accumulation in leaf tissue may function as a plant resistance mechanism against phytophagous insect activity was investigated. GABA accumulation in response to mechanical stimulation, mechanical damage and insect activity was demonstrated. In wt tobacco (Nicotiana tabacum cv Samsun), mechanical stimulation or damage caused GABA to accumulate within 2 min from mean levels of 14 to 37 and 1~9 nmol g-l fresh weight (FW), respectively. In the transgenic tobacco strain CaMVGAD27c overexpressing Petunia GAD, the same treatments caused GABA to accumulate from 12 to 59 and 279 nmol g-l FW, respectively. In the transgenic tobacco strain CaMVGADilC 11 overexpressing Petunia GAD lacking an autoinhibitory domain, mechanical stimulation or damage caused GABA to accumulate from 180 to 309 and 630 nmol g-l FW, respectively. Ambulatory activity by tobacco budworm (TBW) larvae (Heliothis virescens) on leaves of CaMVGAD27c tobacco caused GABA to accumulate from 28 to 80 nmol g-l FW within 5 min. Ambulatory and leaf-rolling activity by oblique banded leaf roller (OBLR) larvae (Choristoneura rosaceana cv Harris) on wt soybean leaves (Glycine max cv Harovinton) caused GABA to accumulate from 60 to 1123 nmol g-l FW within 20 min. Increased GABA levels in leaf tissue were shown to affect phytophagous preference in TBW larvae presented with wt and transgenic tobacco leaves. When presented with leaves of Samsun wt and CaMVGAD27c plants, TBW larvae consumed more wt leaf tissue (640 ± 501 S.D. mm2 ) than transgenic leaf tissue (278 ± 338 S.D. mm2 ) nine times out of ten. When presented with leaves of Samsun wt and CaMVGAD~C11 plants, TBW larvae consumed more transgenic leaf tissue (1219 ± 1009 S.D. mm2 ) than wt leaf tissue (28 ± 31 S.D. mm2 ) ten times out of ten. These results indicate that: (1) ambulatory activity of insect larvae on leaves results in increased GABA levels, (2) transgenic tobacco leaves with increased capacity for GABA synthesis deter feeding, and (3) transgenic tobacco leaves with constitutively higher GABA levels stimulate feeding.

Changes in the magnitude and pattern of translocation of photoassimilated ¹CO in soybean plants following an acute exposure to gamma radiation /

Young soybean plants (Glycine ~. L. cultivar Harosoy '63), grown under controlled conditions, were exposed to gamma radiation on a single occasion. One hour following exposure to 3,750 rads, the mature trifoliate leaf of the soybean plant was isolated in a closed system and permitted to photoassimilate approximately 1-5 pCi of 14C02 for 15 minutes. After an additional 45 minute-period, the plant was sacrificed and the magnitude of translocation and distribution pattern of 14C determined. In the non-irradiated plants 18~ of the total 14C recovered was outside the fed leaf blades and of this translocated 14c, 28~ was above the node of the fed leaf, 38~ in the stem below the node, 28~ in the roots and 7~ in the petiole. As well, in the irradiated plants, a smaller per cent (6~) of the total 14 C recovered was exported out of the source leaf blades. Of this translocated 14c , a smaller per cent (20~) was found in the apical region above the node of the source leaf and a higher per cent (45~) was recovered from the stem below the node and in the petiole (11~). The per cent of exported 14 C recovered from the root was unaffected by the radiation. Replacement of the shoot apex with 20 ppm IAA immediately following irradiation, only J partially increased the magnitude of translocation but did completely restore the pattern of distribution to that observed in the non-irradiated plants. From supplementary studies showing a radiationinduced reduction of photosynthetic rates in the source leaf and a reduction of the cumulative stem and leaf lengths in the apical sink region, the observed effects of radiation on the translocation process have been correlated to damage incurred by the source and sink regions. These data suggest that the reduction in the magnitude of translocation is the result of damage to both the source and sink regions rather than the phloem conducting tissue itself, whereas the change in the pattern of translocation is probably the result of a reduced rate of 14C-assimilate movement caused by a radiation-induced decrease of sink metabolism, especially the decrease in the metabolism of the apical sink.

Rapid [Gamma]-amino acid synthesis and the inhibition of the growth and development of oblique banded leaf-roller larvae

The hypothesis that rapid y-aminobutyric acid (GABA) accumulation is a plant defense against phytophagous insects was investigated. Simulation of mechanical damage resulting from phytophagous insect activity increased soybean (Glycine max L.) leaf GABA 10- to 25-fold within 1 to 4 min. Pulverizing leaf tissue resulted in a value of 2. 15 (±O. 11 SE) ~mol GABA per gram fresh weight. Increasing the GABA levels in a synthetic diet from 1.6 to 2.6 Jlffiol GABA per gram fresh weight reduced the growth rates, developmental rates, total biomass (50% reduction), and survival rates (30% reduction) of cultured Oblique banded leaf-roller (OBLR) (Choristonellra rosacealla Harris) larvae. In field experiments OBLR larvae were found predominantly on young terminal leaves which have a reduced capacity to produce GABA in response to mechanical damage. Glutamate decarboxylase (GAD) is a cytosolic enzyme which catalyses the decarboxylation of L-Glu to GABA. GAD is a calmodulin binding enzyme whose activity is stimulated dramatically by increased cytosolic H+ or Ca2 + ion concentrations. Phytophagous insect activity will disrupt the cellular compartmentation of H+ and Ca2 +, activate GAD and subsequent GABA accumulation. In animals GABA is a major inhibitory neurotransmitter. The possible mechanisms resulting in GABA inhibited growth and development of insects are discussed.