Bond-charge calculation of nonlinear optical susceptibilities of LiXO3 type complex crystals

Second order nonlinear optical (NLO) tensor coefficients of LiXO3 (X = I, Nb, Ta) type crystals have been evaluated on the basis of the dielectric theory of complex crystals and the modified bond charge model. The current method is capable of calculating single bond contributions to the total second order NLO susceptibility. The tenser values thus calculated agree well with experimental data. By introducing the subformula equation and the concept of the effective charge of one valence electron, we are able to successfully treat such complex crystals as LiXO3 type compounds. In addition, the bond charge expression is modified to a more reasonable form for complex crystals. (C) 1998 Elsevier Science B.V.

Pyramidal quantum dots: single and entangled photon sources and correlation studies

Practical realisation of quantum information science is a challenge being addressed by researchers employing various technologies. One of them is based on quantum dots (QD), usually referred to as artificial atoms. Being capable to emit single and polarization entangled photons, they are attractive as sources of quantum bits (qubits) which can be relatively easily integrated into photonic circuits using conventional semiconductor technologies. However, the dominant self-assembled QD systems suffer from asymmetry related problems which modify the energetic structure. The main issue is the degeneracy lifting (the fine-structure splitting, FSS) of an optically allowed neutral exciton state which participates in a polarization-entanglement realisation scheme. The FSS complicates polarization-entanglement detection unless a particular FSS manipulation technique is utilized to reduce it to vanishing values, or a careful selection of intrinsically good candidates from the vast number of QDs is carried out, preventing the possibility of constructing vast arrays of emitters on the same sample. In this work, site-controlled InGaAs QDs grown on (111)B oriented GaAs substrates prepatterned with 7.5 μm pitch tetrahedrons were studied in order to overcome QD asymmetry related problems. By exploiting an intrinsically high rotational symmetry, pyramidal QDs were shown as polarization-entangled photon sources emitting photons with the fidelity of the expected maximally entangled state as high as 0.721. It is the first site-controlled QD system of entangled photon emitters. Moreover, the density of such emitters was found to be as high as 15% in some areas: the density much higher than in any other QD system. The associated physical phenomena (e.g., carrier dynamic, QD energetic structure) were studied, as well, by different techniques: photon correlation spectroscopy, polarization-resolved microphotoluminescence and magneto-photoluminescence.

Development of large-scale colloidal crystallisation methods for the production of photonic crystals

Colloidal photonic crystals have potential light manipulation applications including; fabrication of efficient lasers and LEDs, improved optical sensors and interconnects, and improving photovoltaic efficiencies. One road-block of colloidal selfassembly is their inherent defects; however, they can be manufactured cost effectively into large area films compared to micro-fabrication methods. This thesis investigates production of ‘large-area’ colloidal photonic crystals by sonication, under oil co-crystallization and controlled evaporation, with a view to reducing cracking and other defects. A simple monotonic Stöber particle synthesis method was developed producing silica particles in the range of 80 to 600nm in a single step. An analytical method assesses the quality of surface particle ordering in a semiquantitative manner was developed. Using fast Fourier transform (FFT) spot intensities, a grey scale symmetry area method, has been used to quantify the FFT profiles. Adding ultrasonic vibrations during film formation demonstrated large areas could be assembled rapidly, however film ordering suffered as a result. Under oil cocrystallisation results in the particles being bound together during film formation. While having potential to form large areas, it requires further refinement to be established as a production technique. Achieving high quality photonic crystals bonded with low concentrations (<5%) of polymeric adhesives while maintaining refractive index contrast, proved difficult and degraded the film’s uniformity. A controlled evaporation method, using a mixed solvent suspension, represents the most promising method to produce high quality films over large areas, 75mm x 25mm. During this mixed solvent approach, the film is kept in the wet state longer, thus reducing cracks developing during the drying stage. These films are crack-free up to a critical thickness, and show very large domains, which are visible in low magnification SEM images as Moiré fringe patterns. Higher magnification reveals separation between alternate fringe patterns are domain boundaries between individual crystalline growth fronts.

Polymer and metallodielectric based photonic crystals

The bottom-up colloidal synthesis of photonic crystals has attracted interest over top-down approaches due to their relatively simplicity, the potential to produce large areas, and the low-costs with this approach in fabricating complex 3-dimensional structures. This thesis focuses on the bottom-up approach in the fabrication of polymeric colloidal photonic crystals and their subsequent modification. Poly(methyl methacrylate) sub-micron spheres were used to produce opals, inverse opals and 3D metallodielectric photonic crystal (MDPC) structures. The fabrication of MDPCs with Au nanoparticles attached to the PMMA spheres core–shell particles is described. Various alternative procedures for the fabrication of photonic crystals and MDPCs are described and preliminary results on the use of an Au-based MDPC for surface-enhanced Raman scattering (SERS) are presented. These preliminary results suggest a threefold increase of the Raman signal with the MDPC as compared to PMMA photonic crystals. The fabrication of PMMA-gold and PMMA-nickel MDPC structures via an optimised electrodeposition process is described. This process results in the formation of a continuous dielectric-metal interface throughout a 3D inverted photonic crystal structure, which are shown to possess interesting optical properties. The fabrication of a robust 3D silica inverted structure with embedded Au nanoparticles is described by a novel co-crystallisation method which is capable of creating a SiO2/Au NP composite structure in a single step process. Although this work focuses on the creation of photonic crystals, this co-crystallisation approach has potential for the creation of other functional materials. A method for the fabrication of inverted opals containing silicon nanoparticles using aerosol assisted chemical vapour deposition is described. Silicon is a high dielectric material and nanoparticles of silicon can improve the band gap and absorption properties of the resulting structure, and therefore have the potential to be exploited in photovoltaics.

Weakly nonlinear effects associated with transverse oscillations in dusty plasma crystals

We study the amplitude modulation of transverse dust lattice waves (TDLW) propagating in a single- and double-layer dusty plasma (DP) crystal. It is shown that a modulational instability mechanism, which is related to an intrinsic nonlinearity of the sheath electric field, may occur under certain conditions. Possibility of the formation of localized excitations (envelope solitons) in the dusty plasma crystal is discussed.

The preparation of highly ordered single layer ZSM-5 coating on prefabricated stainless steel microchannels

An elegant way to prepare catalytically active microreactors is by applying a coating of zeolite crystals onto a metal microchannel structure. In this study the hydrothermal formation of ZSM-5 zeolitic coatings on AISI 316 stainless steel plates with a microchannel structure has been investigated at different synthesis mixture compositions. The procedures of coating and thermal treatment have also been optimized. Obtaining a uniform thickness of the coating within 0.5 mm wide microchannels requires a careful control of various synthesis variables. The role of these factors and the problems in the synthesis of these zeolitic coatings are discussed. In general, the synthesis is most sensitive to the H2O/Si ratio as well as to the orientation of the plates with respect to the gravity vector. Ratios of H2O/Si=130 and Si/template=13 were found to be optimal for the formation of a zeolitic film with a thickness of one crystal at a temperature of 130 degreesC and a synthesis time of about 35 h. At such conditions, ZSM-5 crystals were formed with a typical size of 1.5 mu mx1.5 mu mx1.0 mum and a very narrow (within 0.2 mum) crystal size distribution. The prepared samples proved to be active in the selective catalytic reduction (SCR) of NO with ammonia. The activity tests have been carried out in a plate-type microreactor. The microreactor shows no mass transfer limitations and a larger SCR reaction rate is observed in comparison with pelletized Ce-ZSM-5 catalysts; (C) 2001 Elsevier Science B.V. All rights reserved.

Exciton-mediated photothermal cooling in GaAs membranes

Cooling of the mechanical motion of a GaAs nano-membrane using the photothermal effect mediated by excitons was recently demonstrated by some of the authors (Usami et al 2012 Nature Phys. 8 168) and provides a clear example of the use of thermal forces to cool down mechanical motion. Here, we report on a single-free-parameter theoretical model to explain the results of this experiment which matches the experimental data remarkably well.

Magnetic properties of the Biâ Srâ CaCuâ Oâ single crystal

The Bi2Sr2CaCu20g single crystal with a superconducting transition temperature equal to 90 ± 2 K was prepared. The irreversibility line of the single crystal for a mgnetic field direction along the c-axis and T* in the ab-plane was determined. The reduced temperature (l - T ) is proportional to H 1.1 for fields below 004 T and proportional to HO.09 for fields above 0.4 T. The zero temperature upper critical field Hc2(0) and coherence length ~ (0) were determined from the magnetization meaurements to be H-lC2=35.9T , H//C2=31.2T, ~c(0)=35.0 A, and ~ab(0)=32.5A,and from the magnetoresistance measurements to be H-lc2 = 134.6T , H//C2=55.5T '~c(0)=38.1 A, and ~ab(0)=2404 A for both directions of the applied magnetic field. The results obtained for Hc2(0) and ~(O) are not reliable due to the rounding that the single crystal exhibits in the magnetization and magnetoresistance curves. The magnetization relaxation of the single crystal was investigated, and was found to be logarithmic in time, and the relaxation rate increases with temperature up to 50 -60 K, then decreases at higher temperatures.

Use of mirage effect for the detection of phase transitions in liquid crystals

he phenomenon of single beam mirage effect, otherwise known as photothermal deflection (PTD) effect using a He–Ne laser beam has been employed to detect phase transitions in some liquid crystals. It has been observed that anomalous changes in amplitude occur in the PTD signal level near the transition temperature. The experimental details and the results of measurements made in liquid crystals E8, M21 and M24 are given in this paper.

Supramolecular helix and beta-sheet through self-assembly of two isomeric tetrapeptides in crystals and formation of filaments and ribbons in the solid state

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Crystal design approaches for the synthesis of paracetamol co-crystals

Crystal engineering principles were used to design three new co-crystals of paracetamol. A variety of potential cocrystal formers were initially identified from a search of the Cambridge Structural Database for molecules with complementary hydrogen-bond forming functionalities. Subsequent screening by powder X-ray diffraction of the products of the reaction of this library of molecules with paracetamol led to the discovery of new binary crystalline phases of paracetamol with trans-1,4- diaminocyclohexane (1); trans-1,4-di(4-pyridyl)ethylene (2); and 1,2-bis(4-pyridyl)ethane (3). The co-crystals were characterized by IR spectroscopy, differential scanning calorimetry, and 1H NMR spectroscopy. Single crystal X-ray structure analysis reveals that in all three co-crystals the co-crystal formers (CCF) are hydrogen bonded to the paracetamol molecules through O−H···N interactions. In co-crystals (1) and (2) the CCFs are interleaved between the chains of paracetamol molecules, while in co-crystal (3) there is an additional N−H···N hydrogen bond between the two components. A hierarchy of hydrogen bond formation is observed in which the best donor in the system, the phenolic O−H group of paracetamol, is preferentially hydrogen bonded to the best acceptor, the basic nitrogen atom of the co-crystal former. The geometric aspects of the hydrogen bonds in co-crystals 1−3 are discussed in terms of their electrostatic and charge-transfer components.

Using laboratory and field measurements to constrain a single habit shortwave optical parameterization for cirrus

A single habit parameterization for the shortwave optical properties of cirrus is presented. The parameterization utilizes a hollow particle geometry, with stepped internal cavities as identified in laboratory and field studies. This particular habit was chosen as both experimental and theoretical results show that the particle exhibits lower asymmetry parameters when compared to solid crystals of the same aspect ratio. The aspect ratio of the particle was varied as a function of maximum dimension, D, in order to adhere to the same physical relationships assumed in the microphysical scheme in a configuration of the Met Office atmosphere-only global model, concerning particle mass, size and effective density. Single scattering properties were then computed using T-Matrix, Ray Tracing with Diffraction on Facets (RTDF) and Ray Tracing (RT) for small, medium, and large size parameters respectively. The scattering properties were integrated over 28 particle size distributions as used in the microphysical scheme. The fits were then parameterized as simple functions of Ice Water Content (IWC) for 6 shortwave bands. The parameterization was implemented into the GA6 configuration of the Met Office Unified Model along with the current operational long-wave parameterization. The GA6 configuration is used to simulate the annual twenty-year short-wave (SW) fluxes at top-of-atmosphere (TOA) and also the temperature and humidity structure of the atmosphere. The parameterization presented here is compared against the current operational model and a more recent habit mixture model.

Exciton behavior in GaAs/AlGaAs coupled double quantum wells with interface disorder

In this work, we present a detailed study on the optical properties of two GaAs/Al(0.35)Ga(0.65)As coupled double quantum wells (CDQWs) with inter-well barriers of different thicknesses, by using photoluminescence (PL) spectroscopy. The two CDQWs were grown in a single sample, assuring very similar experimental conditions for measurements of both. The PL spectrum of each CDQW exhibits two recombination channels which can be accurately identified as the excitonic e(1)-hh(1) transitions originated from CDQWs of different effective dimensions. The PL spectra characteristics and the behavior of the emissions as a function of temperature and excitation power are interpreted in the scenario of the bimodal interface roughness model, taking into account the exciton migration between the two regions considered in this model and the difference in the potential fluctuation levels between those two regions. The details of the PL spectra behavior as a function of excitation power are explained in terms of the competition between the band gap renormalization (BGR) and the potential fluctuation effects. The results obtained for the two CDQWs, which have different degrees of potential fluctuation, are also compared and discussed. (C) 2009 Elsevier B.V. All rights reserved.

Single-step chemical synthesis of ferrite hollow nanospheres

We report a single-step chemical synthesis of iron oxide hollow nanospheres with 9.3 nm in diameter. The sample presents a narrow particle diameter distribution and chemical homogeneity. The hollow nature of the particles is confirmed by HRTEM and HAADF STEM analysis. Electron and x-ray diffraction show that the outer material component is constituted by 2 nm ferrite crystals. Mossbauer data provide further evidence for the formation of iron oxide with high structural disorder, magnetically ordered at 4.2 K and superparamagnetism at room temperature. An unusual magnetic behavior under an applied field is reported, which can be explained by the large fraction of atoms existing at both inner and outer surfaces.