A review of Skutzia Reiss, 1985, with the description of three new species (Diptera:Chironomidae:Chironominae)

Skutzia epleri sp. n. from USA, S. inthanonensis sp. n. from Thailand, and S. quetzali sp. n. from Panama and Mexico are described and figured as male imagines, and S. gaianii Andersen is recorded from Trinidad and Tobago. The genus now consists of 6 species. In addition to the species mentioned above, S. inopinata Reiss from Canada and S. bahiensis Reiss from Brazil are included. Skutzia is placed in the subtribe Zavreliina of the tribe Tanytarsini, but because the immatures are not known, this placement must be regarded as tentative. The distribution of the genus, previously known only from the Nearctic and the Neotropical regions, is expanded to include the Oriental region, indicating a Beringian connection. An emended diagnosis and a key to the males of Skutzia are provided.

Increased Transactivation Associated with SOX3 Polyalanine Tract Deletion in a Patient with Hypopituitarism

Backgound and Aims: Correct gene dosage of SOX3 is critical for the development of the hypothalamo-pituitary axis. Both overdosage of SOX3, as a result of gene duplication, and loss of function resulting from expansion of the first polyalanine (PA) tract are associated with variable degrees of hypopituitarism, with or without mental retardation. The aim of this study was to further investigate the contribution of SOX3 in the etiology of hypopituitarism and the mechanisms involved in the phenotypic variability. Methods: We screened 154 patients with congenital hypopituitarism and an undescended posterior pituitary for mutations in SOX3 and variability in the length of the first PA tract. In addition, 300 patients with variable septooptic dysplasia were screened for variability of the PA tract. Results: We report a novel 18-base pair deletion (p.A243_A248del6, del6PA) in a female patient with hypopituitarism resulting in a 2-fold increase in transcriptional activation in vitro, compared with wild-type SOX3. We also identified a previously reported seven-alanine expansion (p.A240_A241ins7, +7PA) in two male siblings with isolated GH deficiency and a distinct phenotype, in addition to the nonsynonymous variant p.R5Q in an unrelated individual; this appears to have no functional effect on the protein. In contrast to +7PA, del6PA maintained its ability to repress beta-catenin mediated transcription in vitro. Conclusion: This is the first study to report that PA tract deletions associated with hypopituitarism have functional consequences in vitro, possibly due to increased activation of SOX3 target genes. In addition, we have expanded the phenotypic spectrum associated with PA tract expansion (+7PA) mutations to include panhypopituitarism or isolated GH deficiency, with or without mental retardation. (J Clin Endocrinol Metab 96: E685-E690, 2011)

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

A transformation toughening white cast iron

An experimental white cast iron with the unprecedented fracture tough ness of 40 MPa m(1/2) is currently being studied to determine the mechanisms of toughening. This paper reports the investigation of the role of strain-induced martensitic (SIM) transformation. The dendritic microconstituent in the toughened alloy consists primarily of retained austenite, with precipitated M(7)C(3) carbides and some martensite. Refrigeration experiments and differential scanning calorimetry (DSC) were used to demonstrate, firstly, that this retained austenite has an ''effective'' sub-ambient M(S) temperature and, secondly, that SIM transformation can occur at ambient temperatures. Comparison between room temperature and elevated temperature K-Ic tests showed that the observed SIM produces a transformation toughening response in the alloy, contributing to, but not fully accounting for, its high tough ness. SIM as a mechanism for transformation toughening has not previously been reported for white cast irons. Microhardness traverses on crack paths and X-ray diffraction (XRD) on fracture surfaces confirmed the interpretation of the K-Ic experiments. Further DSC and quantitative XRD showed that, as heat-treatment temperature is varied, there is a correlation between fracture toughness and the volume fraction of unstable retained austenite.

Transmission electron microscopy of a transformation toughened white cast iron

Transmission electron microscopy has been used to study the microstructure of an experimental white cast iran, in which a combination of modified alloy composition and unconventional heat treatment has resulted in a fracture toughness of 40 MPa m(-1/2). Microstructural features of the alloy that contribute to the toughness improvement and hence distinguish it from conventional white irons have been investigated. In the as-cast condition the dendrites are fully austenitic and the eutectic consists of M7C3 carbides and martensite. During heat treatment at 1130 degrees C the austenite is partially destabilized by precipitation of chromium-rich M7C3 carbides. This results in a dendritic microconstituent consisting of bulk retained austenite and secondary carbides which are sheathed with martensite. The martensite sheaths, which contain interlath films of retained austenite, are irregular in shape with some laths extending into the bulk retained austenite. Emphasis has been placed on the morphology, distribution, and stability of the retained austenite and its transformation products in the dendrites. The implications of these findings on the transformation toughening mechanism in this alloy are discussed.

Equivalent Neurogenic Potential of Wild-Type and GFP-Labeled Fetal-Derived Neural Progenitor Cells Before and After Transplantation Into the Rodent Hippocampus

Introduction. The hippocampal formation is a specific structure in the brain where neurogenesis occurs throughout adulthood and in which the neuronal cell loss causes various demential states. The main goal of this study was to verify whether fetal neural progenitor cells (NPCs) from transgenic rats expressing green fluorescent protein (GFP) retain the ability to differentiate into neuronal cells and to integrate into the hippocampal circuitry after transplantation. Methods. NPCs were isolated from E14 (gestational age: 14 days postconception) transgenic-Lewis and wild-type Sprague-Dawley rat embryos. Wild-type and transgenic cells were expanded and induced to differentiate into a neuronal lineage in vitro. Immunocytochemical and electrophysiological analysis were performed in both groups. GFP-expressing cells were implanted into the hippocampus and recorded electrophysiologically 3 months thereafter. Immunohistochemical analysis confirmed neuronal differentiation, and the yield of neuronal cells was determined stereologically. Results. NPCs derived from wild-type and transgenic animals are similar regarding their ability to generate neuronal cells in vitro. Neuronal maturity was confirmed by immunocytochemistry and electrophysiology, with demonstration of voltage-gated ionic currents, firing activity, and spontaneous synaptic currents. GFP-NPCs were also able to differentiate into mature neurons after implantation into the hippocampus, where they formed functional synaptic contacts. Conclusions. GFP-transgenic cells represent an important tool in transplantation studies. Herein, we demonstrate their ability to generate functional neurons both in vitro and in vivo conditions. Neurons derived from fetal NPCs were able to integrate into the normal hippocampal circuitry. The high yield of mature neurons generated render these cells important candidates for restorative approaches based on cell therapy.

Influence of Modified Posterior Reconstruction of the Rhabdosphincter on Early Recovery of Continence and Anastomotic Leakage Rates after Robot-Assisted Radical Prostatectomy

Background: Posterior reconstruction (PR) of the rhabdosphincter has been previously described during retropubic radical prostatectomy, and shorter times to return of urinary continence were reported using this technical modification. This technique has also been applied during robot-assisted radical prostatectomy (RARP); however, contradictory results have been reported. Objective: We describe here a modified technique for PR of the rhabdosphincter during RARP and report its impact on early recovery of urinary continence and on cystographic leakage rates. Design, setting, and participants: We analyzed 803 consecutive patients who underwent RARP by a single surgeon over a 12-mo period: 330 without performing PR and 473 with PR. Surgical procedure: The reconstruction was performed using two 6-in 3-0 Poliglecaprone sutures tied together. The free edge of the remaining Denonvillier`s fascia was identified after prostatectomy and approximated to the posterior aspect of the rhabdosphincter and the posterior median raphe using one arm of the continuous suture. The second layer of the reconstruction was then performed with the other arm of the suture, approximating the posterior lip of the bladder neck and vesicoprostatic muscle to the posterior urethral edge. Measurements: Continence rates were assessed with a self-administrated, validated questionnaire (Expanded Prostate Cancer Index Composite) at 1, 4, 12, and 24 wk after catheter removal. Continence was defined as the use of ""no absorbent pads."" Cystogram was performed in all patients on postoperative day 4 or 5 before catheter removal. Results and limitations: There was no significant difference between the groups with respect to patient age, body mass index, prostate-specific antigen levels, prostate weight, American Urological Association symptom score, estimated blood loss, operative time, number of nerve-sparing procedures, and days with catheter. In the PR group, the continence rates at 1, 4, 12, and 24 wk postoperatively were 22.7%, 42.7%, 91.8%, and 96.3%, respectively; in the non-PR group, the continence rates were 28.7%, 51.6%, 91.1%, and 97%, respectively. The modified PR technique resulted in significantly higher continence rates at 1 and 4 wk after catheter removal (p = 0.048 and 0.016, respectively), although the continence rates at 12 and 24 wk were not significantly affected (p = 0.908 and p = 0.741, respectively). The median interval to recovery of continence was also statistically significantly shorter in the PR group (median: 4 wk; 95% confidence interval [CI]: 3.39-4.61) when compared to the non-PR group (median: 6 wk; 95% CI: 5.18-6.82; log-rank test, p = 0.037). Finally, the incidence of cystographic leaks was lower in the PR group (0.4% vs 2.1%; p = 0.036). Although the patients` baseline characteristics were similar between the groups, the patients were not preoperatively randomized and unknown confounding factors may have influenced the results. Conclusions: Our modified PR combines the benefits of early recovery of continence reported with the original PR technique with a reinforced watertight closure of the posterior anastomotic wall. Shorter interval to recovery of continence and lower incidence of cystographic leaks were demonstrated with our PR technique when compared to RARP with no reconstruction. (C) 2010 European Association of Urology. Published by Elsevier B.V. All rights reserved.

Use of Acoustic Doppler Sonography to Ascertain the Feasibility of the Pedicled Nasoseptal Flap After Prior Bilateral Sphenoidotomy

Objectives/Hypothesis: Blood supply to the Hadad-Bassagasteguy pedicled nasoseptal flap may be interrupted by surgery of the pterygopalatine fossa, posterior septectomy, or large sphenoidotomies. This would preclude its use for reconstruction of skull base defects after expanded endonasal approaches (EEA). We present a novel method to ascertain the patency of the nasoseptal artery after prior surgery, and consequently the availability of the nasoseptal flap, using acoustic Doppler sonography. Study Design: Retrospective clinical review. Methods: Four patients who underwent EEAs were evaluated intraoperatively with acoustic Doppler sonography. The mucosa that covers the inferior aspect of the rostrum of the sphenoid sinus was scanned with the tip of the probe. Reflection of sound waves representing intravascular blood flow was assessed. Results: In three patients, the artery was identified in at least one side. One remaining patient showed no acoustic signal suggesting loss of the nasoseptal artery bilaterally, therefore necessitating the use of a fat graft for the reconstruction. Conclusions: Acoustic Doppler sonography seems to be a feasible and effective way to ascertain the availability of the nasoseptal artery. It is a relatively inexpensive and simple technique that can be performed by any endoscopic surgeon.

Familial neuromyelitis optica

Background: Detection of aquaporin-4-specific immunoglobulin G (IgG) has expanded the spectrum of neuromyelitis optica (NMO). Rare reports of familial aggregation have suggested a component of genetic susceptibility but these reports mostly antedated the discovery of the NMO-IgG biomarker and recently updated diagnostic criteria. Methods: We report a case series describing the demographic, clinical, neuroimaging, and NMO-IgG serologic status of 12 multiplex NMO pedigrees with a total of 25 affected individuals. Results: Twenty-one patients (84%) were women. Families were Asian (n = 5), Latino (n = 4), white (n = 1), or African (n = 2). Apparent transmission was either maternal (n = 5) or paternal (n = 2). In 1 family, 3 individuals had NMO; in the others, 2 individuals were affected. Sibling pairs (n = 6), parent-child (n = 4), and aunt-niece (n = 3) pairs were observed. Nineteen patients (76%) were NMO-IgG positive. Twelve (48%) had clinical or serologic evidence of another autoimmune disease. Familial occurrence of NMO occurs in approximately 3% of patients with well-established diagnosis of NMO. Conclusions: A small proportion of patients with NMO have relatives with this condition, but familial occurrence is more common than would be expected from its frequency in the general population. Familial NMO is indistinguishable from sporadic NMO based on clinical symptoms, age at onset, sex distribution, and frequency of NMO-IgG detection. One or 2 generations were affected and affected individuals represented a small fraction of family members. Taken together, these data suggest complex genetic susceptibility in NMO. Neurology (R) 2010;75:310-315

Urothelial carcinoma transmission via kidney transplantation

Transmission of urothelial carcinoma via solid organ transplant has never been reported in the literature to our knowledge. We report a case of transmission of this tumour to a kidney recipient. The donor was a 37-year-old woman, victim of a subarachnoid haemorrhage. The recipient was a 21-year-old girl, with a history of chronic kidney disease secondary to neurogenic bladder. This fatality has been rarely described in literature, but never with this histological type of cancer. Nowadays, with the expanded criteria for donation, older people are accepted as donor because of the shortage of organs. However, this may increase the likelihood of the number of cancer transmission.

GB virus type C infection modulates T-cell activation independently of HIV-1 viral load

Background: Many clinical studies have suggested a beneficial effect of GB virus type C (GBV-C) on the course of HIV-1 infection, but the mechanisms involved in such amelioration are not clear. As recent evidence has implicated cellular activation in HIV-1 pathogenesis, we investigated the effect of GBV-C viremia on T-cell activation in early HIV-1 infection. Methods: Forty-eight recently infected HIV-1 patients (23 GBV-C viremic) were evaluated for T-cell counts, expanded immunophenotyping GBV-C RNA detection, and HIV-1 viral load. Nonparametric univariate and multivariate analyses were carried out to identify variables associated with cellular activation, including GBV-C status, HIV-1 viral load, T lymphocyte counts, and CD38 and chemokine (C-C motif) receptor 5 (CCR5) surface expression. Finding: We not only confirmed the positive correlation between HIV-1 viral load and the percentage of T cells positive for CD38(+)CD8(+) but also observed that GBV-C viremic patients had a lower percentage of T cells positive for CD38(+)CD4(+), CD38(+)CD8(+), CCR5(+)CD4(+), and CCR5(+)CD8(+) compared with HIV-1-infected patients who were not GBV-C viremic. In regression models, GBV-C RNA(+) status was associated with a reduction in the CD38 on CD4(+) or CD8(+) T cells and CCR5(+) on CD8(+) T cells, independent of the HIV-1 viral load or CD4(+) and CD8(+) T-cell counts. These results were also supported by the lower expression of CD69 and CD25 in GBV-C viremic patients. Interpretation: The association between GBV-C replication and lower T-cell activation may be a key mechanism involved in the protection conferred by this virus against HIV-1 disease progression to immunodeficiency in HIV-1-infected patients. (C) 2009 Wolters Kluwer Health | Lippincott Williams & Wilkins

Periurethral Suspension Stitch During Robot-Assisted Laparoscopic Radical Prostatectomy: Description of the Technique and Continence Outcomes

Background: Several studies have shown that robot-assisted laparoscopic radical prostatectomy (RALP) is feasible, with favorable complication rates and short hospital times. However, the early recovery of urinary continence remains a challenge to be overcome. Objective: We describe our technique of periurethral retropubic suspension stitch during RALP and report its impact on early recovery of urinary continence. Design, setting, and participants: We analyze prospectively 331 consecutive patients who underwent RALP, 94 without the placement of suspension stitch (group 1) and 237 with the application of the suspension stitch (group 2). Surgical procedure: The only difference between the groups was the placement of the puboperiurethral stitch after the ligation of the dorsal venous complex (DVC). The periurethral retropubic stitch was placed using a 12-in monofilament polyglytone suture on a CTI needle. The stitch was passed from right to left between the urethra and DVC, and then through the periostium on the pubic bone. The stitch was passed again through the DVC, and then through the pubic bone in a figure eight, and then tied. Measurements: Continence rates were assessed with a self-administered validated questionnaire (Expanded Prostate Cancer Index Composite [EPIC] at 1, 3, 6, and 12 mo after the procedure. Continence was defined as the use of no absorbent pads or no leakage of urine. Results and limitations: In group 1, the continence rate at 1, 3, 6, and 12 mo postoperatively was 33%, 83%, 94.7%, and 95.7%, respectively; in group 2, the continence rate was 40%, 92.8%, 97.9%, and 97.9%, respectively. The suspension technique resulted in significantly greater continence rates at 3 mo after RALP (p = 0.013). The median/mean interval to recovery of continence was also statistically significantly shorter in the suspension group (median: 6 wk; mean: 7.338 wk: 95% confidence interval [CI]: 6.387-8.288) compared to the non-suspension group (median: 7 wk; mean: 9.585 wk: 95% CI: 7.558-11.612; log rank test, p = 0.02). Conclusions: The suspension stitch during RALP resulted in a statistically significantly shorter interval to recovery of continence and higher continence rates at 3 mo after the procedure. (C) 2009 European Association of Urology. Published by Elsevier B.V. All rights reserved.

Nonhuman primate models and the failure of the Merck HIV-1 vaccine in humans

The adenovirus type 5 (Ad5)-based vaccine developed by Merck failed to either prevent HIV-1 infection or suppress viral load in subsequently infected subjects in the STEP human Phase 2b efficacy trial. Analogous vaccines had previously also failed in the simian immunodeficiency virus (SIV) challenge-rhesus macaque model. In contrast, vaccine protection studies that used challenge with a chimeric simian-human immunodeficiency virus (SHIV89.6P) in macaques did not predict the human trial results. Ad5 vector -based vaccines did not protect macaques from infection after SHIV89.6P challenge but did cause a substantial reduction in viral load and a preservation of CD4(+) T cell counts after infection, findings that were not reproduced in the human trials. Although the SIV challenge model is incompletely validated, we propose that its expanded use can help facilitate the prioritization of candidate HIV-1 vaccines, ensuring that resources are focused on the most promising candidates. Vaccine designers must now develop T cell vaccine strategies that reduce viral load after heterologous challenge.

Placental transmogrification of the lung presenting as giant bullae with soft-fatty components

A 44-year-old man presented with progressive dyspnea and a previous pneumothorax. Chest CT scan showed a mediastinal shift due to giant bullae containing soft tissue and fatty components in the left lower lung Lobe, and a right upper lung lobe partially collapsed. The pulmonary function tests revealed forced vital capacity (FVC) 53% (of the predicted) and forced vital capacity in 1 s (FEV1) 52%. Then, resection of the lower lobe was performed with intention to prevent other pneumothoraxes and to revert the upper lobe collapse. The pathological examination showed a placental. transmogrification of the lung (PTL). One month after the surgery, the patient was asymptomatic, the pulmonary function tests normalized and the upper lobe was well expanded. In conclusion, we described the first CT finding of soft tissue and fatty components within the PTL-related bullae, and the PTL should be considered in the differential diagnosis of pulmonary lesions with soft-fatty and air components. (c) 2007 European Association for Cardio-Thoracic Surgery. Published by Elsevier B.V. All rights reserved.

Why Not to Use Kidney Grafts From Elderly Donors

Background. Kidney transplantation is widely recognized as the best treatment in patients who require renal replacement therapy. Although considered a clinical and surgical triumph, it is also a source of frustration because of lack of donor organs and the growth of waiting lists. Strategies need to be developed to increase the supply of organs. One measure is use of expanded criteria for donation. Objective. To evaluate the effect of donor age on cadaver graft survival. Materials and Methods. We reviewed the medical records for 454 patients who underwent kidney transplantation with cadaver donors from April 1987 to December 2003. Results. Donor age had a significant effect on kidney transplant survival. Survival of grafts from donors aged 16 to 40 years (mean, 143.30 months) was significantly greater compared with that of grafts from donors older than 40 years (66.46 months) (P = .005). The HLA matching and cold ischemia time did not significantly affect transplant survival (P = .98 and P = .16, respectively). Conclusions. Kidneys from cadaver donors older than 40 years significantly compromised graft survival, generating a negative effect via early return of recipients to waiting lists and increasing the rate of repeat transplantation, risk of death, and unnecessary costs.