Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Creation of a retinoblastoma mutant with dominant -negative activity

The Retinoblastoma tumor suppressor gene (RB) plays a role in a variety of human cancers. Experimental analyses have indicated that the protein product of the RB gene (pRb) plays a role in cell cycle regulation, and that this protein is required in cellular differentiation, senescence, and cell survival. pRb function is dependent on its ability to bind to cellular factors. There are multiple protein binding domains within pRb. Mutations within these domains which eliminate the ability of pRb to bind its targets result in loss of function. Loss of pRb function leads to tumorigenesis, although uncontrolled cellular proliferation is not a universal response to pRb inactivation. The ultimate response to the loss of pRb is influenced by both the genetic and epigenetic environments. Targeted disruption of RB in mice results in embryonic lethality, demonstrating the requirement for functional pRb in development. Close examination of various tissues from the embryos which lack wildtype RB shows problems in differentiation as well as showing induction of apoptosis. Although disruption of RB has provided useful information, complete inactivation of a gene precludes the possibility of discovering the functions that separate domains may have within the system. Creation of a dominant negative mutant by domain deletion whose phenotype is expressed in the presence of the wildtype may provide information about the intermediate functions of the protein. In addition, tissue specific targeting of a dominant negative mutant of pRb allows for comprehensive analysis of pRb function in organogenesis. In this thesis, a series of RB deletion mutants were created and tested for dominant negative activity as well as cellular localization. A tissue culture assay for dominant negative activity was developed which screens for the phenotype of apoptosis due to loss of pRb function. Two mutants from this series scored positive for dominant negative activity in this assay. The effect of these mutants within the assay environment can be explained by a model in which pRb acts as a facilitator of cell fate pathway decisions. ^

Behavioral decision making and the levels of change: An application of the transtheoretical model to prenatal smoking in low -income women

Despite continued research and public health efforts to reduce smoking during pregnancy, prenatal cessation rates in the United States have decreased and the incidence of low birth weight has increased from 1985 to 1991. Lower socioeconomic status women who are at increased risk for poor pregnancy outcomes may be resistant to current intervention efforts during pregnancy. The purpose of this dissertation was to investigate the determinants of continued smoking and quitting among low-income pregnant women.^ Using data from cross-sectional surveys of 323 low-income pregnant smokers, the first study developed and tested measures of the pros and cons of smoking during pregnancy. The original decisional balance measure for smoking was compared with a new measure that added items thought to be more salient to the target population. Confirmatory factor analysis using structural equation modeling showed neither the original nor new measure fit the data adequately. Using behavioral science theory, content from interviews with the population, and statistical evidence, two 7-item scales representing the pros and cons were developed from a portion (n = 215) of the sample and successfully cross-validated on the remainder of the sample (n = 108). Logistic regression found only pros were significantly associated with continued smoking. In a discriminant function analysis, stage of change was significantly associated with pros and cons of smoking.^ The second study examined the structural relationships between psychosocial constructs representing some of the levels of and the pros and cons of smoking. The cross-sectional design mandates that statements made regarding prediction do not prove causation or directionality from the data or methods analysis. Structural equation modeling found the following: more stressors and family criticism were significantly more predictive of negative affect than social support; a bi-directional relationship was found between negative affect and current nicotine addiction; and negative affect, addiction, stressors, and family criticism were significant predictors of pros of smoking.^ The findings imply reversing the trend of decreasing smoking cessation during pregnancy may require supplementing current interventions for this population of pregnant smokers with programs addressing nicotine addiction, negative affect, and other psychosocial factors such as family functioning and stressors. ^

The role of Ski/Sno oncoproteins as negative regulators of the TGF-beta/SMAD signaling pathway in B -cell non -Hodgkin's lymphoma (NHL-B)

Non-Hodgkin's lymphomas are common tumors of the human immune system, primarily of B cell lineage (NHL-B). Negative growth regulation in the B cell lineage is mediated primarily through the TGF-β/SMAD signaling pathway that regulates a variety of tumor suppressor genes. Ski was originally identified as a transforming oncoprotein, whereas SnoN is an isoform of the Sno protein that shares a large region of homology with Ski. In this study, we show that Ski/SnoN are endogenously over-expressed both in patients' lymphoma cells and NHL-B cell lines. Exogenous TGF-β1 treatment induces down-regulation of Ski and SnoN oncoprotein expression in an NHL-B cell line, implying that Ski and SnoN modulate the TGF-β signaling pathway and are involved in cell growth regulation. Furthermore, we have developed an NHL-B cell line (DB) that has a null mutation in TGF-β receptor type II. In this mutant cell line, Ski/SnoN proteins are not down-regulated in response to TGF-β1 treatment, suggesting that downregulation of Ski and SnoN proteins in NHL-B require an intact functional TGF-β signaling pathway Resting normal B cells do not express Ski until activated by antigens and exogenous cytokines, whereas a low level of SnoN is also present in peripheral blood Go B cells. In contrast, autonomously growing NHL-B cells over-express Ski and SnoN, implying that Ski and SnoN are important cell cycle regulators. To further investigate a possible link between reduction of the Ski protein level and growth inhibition, Ski antisense oligodeoxynucleotides were transfected into NHL-B cells. The Ski protein level was found to decrease to less than 40%, resulting in restoring the effect of TGF-β and leading to cell growth inhibition and G1 cell cycle arrest. Co-immunoprecipitation experiments demonstrated that Ski associates with Smad4 in the nucleus, strongly suggesting that over-expression of the nuclear protein Ski and/or SnoN negatively regulates the TGF-β pathway, possibly by modulating Smad-mediated tumor suppressor gene expression. Together, in NHL-B, the TGF-β/SMAD growth inhibitory pathway is usually intact, but over-expression of the Ski and/or SnoN, which binds to Smad4, abrogates the negative regulatory effects of TGF-β/SMAD in lymphoma cell growth and potentiates the growth potential of neoplastic B cells. ^

Decreased light availability can amplify negative impacts of ocean acidification on calcifying coral reef organisms

Coral reef organisms are increasingly and simultaneously affected by global and local stressors such as ocean acidification (OA) and reduced light availability. However, knowledge of the interplay between OA and light availability is scarce. We exposed 2 calcifying coral reef species (the scleractinian coral Acropora millepora and the green alga Halimeda opuntia) to combinations of ambient and increased pCO2 (427 and 1073 µatm, respectively), and 2 light intensities (35 and 150 µmol photons/m**2/s) for 16 d. We evaluated the individual and combined effects of these 2 stressors on weight increase, calcification rates, O2 fluxes and chlorophyll a content for the species investigated. Weight increase of A. millepora was significantly reduced by OA (48%) and low light intensity (96%) compared to controls. While OA did not affect coral calcification in the light, it decreased calcification in the dark by 155%, leading to dissolution of the skeleton. H. opuntia weight increase was not affected by OA, but decreased (40%) at low light. OA did not affect algae calcification in the light, but decreased calcification in the dark by 164%, leading to dissolution. Low light significantly reduced gross photosynthesis (56 and 57%), net photosynthesis (62 and 60%) and respiration (43 and 48%) of A. millepora and H. opuntia, respectively. In contrast to A. millepora, H. opuntia significantly increased chlorophyll content by 15% over the course of the experiment. No interactive effects of OA and low light intensity were found on any response variable for either organism. However, A. millepora exhibited additive effects of OA and low light, while H. opuntia was only affected by low light. Thus, this study suggests that negative effects of low light and OA are additive on corals, which may have implications for management of river discharge into coastal coral reefs.

Negative effects of ocean acidification on calcification vary within the coccolithophore genus Calcidiscus

A large percentage of CO2 emitted into the atmosphere is absorbed by the oceans, causing chemical changes in surface waters known as ocean acidification (OA). Despite the high interest and increased pace of OA research to understand the effects of OA on marine organisms, many ecologically important organisms remain unstudied. Calcidiscus is a heavily calcified coccolithophore genus that is widespread and genetically and morphologically diverse. It contributes substantially to global calcium carbonate production, organic carbon production, oceanic carbon burial, and ocean-atmosphere CO2 exchange. Despite the importance of this genus, relatively little work has examined its responses to OA. We examined changes in growth, morphology, and carbon allocation in multiple strains of Calcidiscus leptoporus in response to ocean acidification. We also, for the first time, examined the OA response of Calcidiscus quadriperforatus, a larger and more heavily calcified Calcidiscus congener. All Calcidiscus coccolithophores responded negatively to OA with impaired coccolith morphology and a decreased ratio of particulate inorganic to organic carbon (PIC:POC). However, strains responded variably; C. quadriperforatus showed the most sensitivity, while the most lightly calcified strain of C. leptoporus showed little response to OA. Our findings suggest that calcium carbonate production relative to organic carbon production by Calcidiscus coccolithophores may decrease in future oceans and that Calcidiscus distributions may shift if more resilient strains and species become dominant in assemblages. This study demonstrates that variable responses to OA may be strain or species specific in a way that is closely linked to physiological traits, such as cellular calcite quota.