955 resultados para Cell-derived Factor
Resumo:
Conditional oncogene expression in transgenic mice is of interest for studying the oncoprotein requirements during tumorigenesis and for deriving cell lines that can be induced to undergo growth arrest and enhance their differentiated functions. We utilized the bacterial tetracycline (Tet)-resistance operon regulatory system (tet) from Tn10 of Escherichia coli to control simian virus 40 (SV40) large tumor (T) antigen (TAg) gene expression and to generate conditionally transformed pancreatic beta cells in transgenic mice. A fusion protein containing the tet repressor (tetR) and the activating domain of the herpes simplex virus protein VP16, which converts the repressor into a transcription activator, was produced in beta cells of transgenic mice under control of the insulin promoter. In a separate lineage of transgenic mice, the TAg gene was introduced under control of a tandem array of tet operator sequences and a minimal promoter, which by itself is not sufficient for gene expression. Mice from the two lineages were then crossed to generate double-transgenic mice. Expression of the tetR fusion protein in beta cells activated TAg transcription, resulting in the development of beta-cell tumors. Tumors arising in the absence of Tet were cultured to derive a stable beta-cell line. Cell incubation in the presence of Tet led to inhibition of proliferation, as shown by decreased BrdUrd and [3H]thymidine incorporation. The Tet derivative anhydrotetracycline showed a 100-fold stronger inhibition compared with Tet. When administered in vivo, Tet efficiently inhibited beta-cell proliferation. These findings indicate that transformed beta cells selected for growth during a tumorigenesis process in vivo maintain a dependence on the continuous presence of the TAg oncoprotein for their proliferation. This system provides an approach for generation of beta-cell lines for cell therapy of diabetes as well as conditionally transformed cell lines from other cell types of interest.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
This paper provides a conceptual framework for the estimation of the farm labour and other factor-derived demand and output supply systems. In order to analyse the drivers of labour demand in agriculture and account for the impact of policies on those decisions, it is necessary to acknowledge the interaction between the different factor markets. For this purpose, we present a review of the theoretical background to primal and dual representations of production and some empirical literature that has made use of derived demand systems. The main focus of the empirical work is to study the effect of market distortions in one market, through inefficient pricing, on the demand for other inputs. Therefore, own-price and cross-price elasticities of demand become key variables in the analysis. The dual cost function is selected as the most appropriate approach, where input prices are assumed to be exogenous. A commonly employed specification – and one that is particularly convenient due to its flexible form – is the translog cost function. The analysis consists of estimating the system of cost-share equations, in order to obtain the derived demand functions for inputs. Thus, the elasticities of factor substitution can be used to examine the complementarity/substitutability between inputs.
Resumo:
Distinct glial cell types of the vertebrate peripheral nervous system (PNS) are derived from the neural crest. Here we show that the expression of the Ets domain transcription factor Erm distinguishes satellite glia from Schwann cells beginning early in rat PNS development. In developing dorsal root ganglia (DRG), Erm is present both in presumptive satellite glia and in neurons. In contrast, Erm is not detectable at any developmental stage in Schwann cells in peripheral nerves. In addition, Erm is downregulated in DRG-derived glia adopting Schwann cell traits in culture. Thus, Erm is the first described transcription factor expressed in satellite glia but not in Schwann cells. In culture, the Neuregulin1 (NRG1) isoform GGF2 maintains Erm expression in presumptive satellite cells and reinduces Erm expression in DRG-derived glia but not in Schwann cells from sciatic nerve. These data demonstrate that there are intrinsic differences between these glial subtypes in their response to NRG1 signaling. In neural crest cultures, Erm-positive progenitor cells give rise to two distinct glial subtypes: Erm-positive, Oct-6-negative satellite glia in response to GGF2, and Erm-negative, Oct-6-positive Schwann cells in the presence of serum and the adenylate cyclase activator forskolin. Thus, Erm-positive neural crest-derived progenitor cells and presumptive satellite glia are able to acquire Schwann cell features. Given the in vivo expression of Erm in peripheral ganglia, we suggest that ganglionic Erm-positive cells may be precursors of Schwann cells.
Resumo:
Background Many clinical trials of DC-based immunotherapy involve administration of monocyte-derived DCs (Mo-DC) on multiple occasions. We aimed to determine the optimal cell processing procedures and timing (leukapheresis, RBC depletion and cryopreservation) for generation of Mo-DC for clinical purposes. Methods Leukapheresis was undertaken using a COBE Spectra. Two instrument settings were compared - the standard semi-automated software (Version 4.7) (n = 10) and the fully automated software (Version 6.0) (n = 40). Density gradient centrifugation using Ficoll, Percoll, a combination of these methods or neither for RBC depletion were compared. Outcomes (including cell yield and purity) were compared for cryopreserved unmanipulated monocytes and cryopreserved Mo-DC. Results Software Version 6.0 provided significantly better enrichment for monocytes (P
Resumo:
Thesis (Ph.D.)--University of Washington, 2016-06
Resumo:
Systemic infection activates the hypothalamic-pituitary-adrenal (HPA) axis, and brainstem catecholamine cells have been shown to contribute to this response. However, recent work also suggests an important role for the central amygdala (CeA). Because direct connections between the CeA and the hypothalamic apex of the HPA axis are minimal, the present study investigated whether the bed nucleus of the stria terminalis (BNST) might act as a relay between them. This was done by using an animal model of acute systemic infection involving intravascular delivery of the proinflammatory cytokine interleukin-1 (IL-1, 1 g/kg). Unilateral ibotenic acid lesions encompassing the ventral BNST significantly reduced both IL-1-induced increases in Fos immunoreactivity in corticotropin-releasing factor (CRF) cells of the hypothalamic paraventricular nucleus (PVN) and corresponding increases in adrenocorticotropic hormone (ACTH) secretion. Similar lesions had no effect on CRF cell responses to physical restraint, suggesting that the effects of BNST lesions were not due to a nonspecific effect on stress responses. In further studies, we examined the functional connections between PVN, BNST, and CeA by combining retrograde tracing with mapping of IL-1-induced increases in Fos in BNST and CeA cells. In the case of the BNST, these studies showed that systemic IL-1 administration recruits ventral BNST cells that project directly to the PVN. In the case of the CeA, the results obtained were consistent with an arrangement whereby lateral CeA cells recruited by systemic IL-1 could regulate the activity of medial CeA cells projecting directly to the BNST. In conclusion, the present findings are consistent with the hypothesis that the BNST acts as a relay between the CeA and PVN, thereby contributing to CeA modulation of hypophysiotropic CRF cell responses to systemic administration of IL-1.
Resumo:
The role of growth hormone (GH) in embryonic growth is controversial, yet preimplantation embryos express GH, insulin-like growth factor I (IGF-I) and their receptors. In this study, addition of bovine GH doubled the proportion of two-cell embryos forming blastocysts and increased by about 25% the number of cells in those blastocysts with a concentration-response curve showing maximal activity at 1 pg bovine GH ml(-1), with decreasing activity at higher and lower concentrations. GH increased the number of cells in the trophectoderm by 25%, but did not affect the inner cell mass of blastocysts. Inhibition of cell proliferation by anti-GH antiserum indicated that GH is a potent autocrine or paracrine regulator of the number of trophectoderm cells in vivo. Type 1 IGF receptors (IGF1R) were localized to cytoplasmic vesicles and plasma membrane in the apical domains of uncompacted and compacted eight-cell embryos, but were predominantly apparent in cytoplasmic vesicles of the trophectoderm cells of the blastocyst, similar to GH receptors. Studies using alphaIR3 antiserum which blocks ligand activation of IGF1R, showed that IGF1R participate in the autocrine or paracrine regulation of the number of cells in the inner cell mass by an endogenous IGF-I-IGF1R pathway. However, alphaIR3 did not affect GH stimulation of the number of trophectoderm cells. Therefore, CH does not use secondary actions via embryonic IGF-I to modify the number of blastocyst cells. This result indicates that GH and IGF-I act independently. GH may selectively regulate the number of trophectoderm cells and thus implantation and placental growth. Embryonic GH may act in concert with IGF-I, which stimulates proliferation in the inner cell mass, to optimize blastocyst development.
Resumo:
The granulocyte colony-stimulating factor (G-CSF) and Fit-3 receptor agonist progenipoietin-1 (ProGP-1) has potent effects on dendritic cell (DC) expansion and may be an alternative to G-CSF for the mobilization of stem cells for allogeneic stem cell transplantation (SCT). We studied the ability of stem cell grafts mobilized with this agent to induce graft-versus-host disease (GVHD) to minor and major histocompatibility antigens in the well-described B6 --> B6D2F1 SCT model. ProGP-1, G-CSIF, or control diluent was administered to donor B6 mice. ProGP-1 expanded all cell lineages in the spleen, and unseparated splenocytes from these animals produced large amounts of interleukin 10 (IL-10) and transforming growth factor beta (TGFbeta) whereas the expression of T-cell adhesion molecules was diminished. Transplantation survival was 0%, 50%, and 90% in recipients of control-, G-CSF-, and ProGP-1-treated allogeneic donor splenocytes, respectively (P < .0001). Donor pretreatment with ProGP-1 allowed a 4-fold escalation in T-cell dose over that possible with G-CSF. Donor CD4 T cells from allogeneic SCT recipients of ProGP-1 splenocytes demonstrated an anergic response to host antigen, and cytokine production (interferon gamma [IFNγ], IL-4, and IL-10) was also reduced while CD8 T-cell cytotoxicity to host antigens remained intact. Neither CD11c(hi) DCs nor CD11c(dim)/B220(hi) DCs from ProGP-1-treated animals conferred protection from GVHD when added to control spleen. Conversely, when equal numbers of purified T cells from control-, G-CSF-, or ProGP-1-treated allogeneic donors were added to allogeneic T-cell-depleted control spleen, survival at day 60 was 0%, 15%, and 90%, respectively (P < .0001). The improved survival in recipients of ProGP-1 T cells was associated with reductions in systemic tumor necrosis factor alpha generation and GVHD of the gastrointestinal tract. We conclude that donor pretreatment with ProGP-1 is superior to G-CSIF for the prevention of GVHD after allogeneic SCT, primarily due to incremental affects on T-cell phenotype and function
Resumo:
The use of granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral blood as a source of stem cells has resulted in a high incidence of severe chronic graft-versus-host disease (cGVHD), which compromises the outcome of clinical allogeneic stem cell transplantation. We have studied the effect of G-CSF on both immune complex and fibrotic cGVHD directed to major (DBA/2 --> B6D2F1) or minor (B10.D2 --> BALB/c) histocompatibility antigens. In both models, donor pretreatment with G-CSF reduced cGVHD mortality in association with type 2 differentiation. However, after escalation of the donor T-cell dose, scleroderma occurred in 90% of the recipients of grafts from G-CSF-treated donors. In contrast, only 11% of the recipients of control grafts developed scleroderma, and the severity of hepatic cGVHD was also reduced. Mixing studies confirmed that in the presence of high donor T-cell doses, the severity of scleroderma was determined by the non-T-cell fraction of grafts from G-CSF-treated donors. These data confirm that the induction of cGVHD after donor treatment with G-CSF is dependent on the transfer of large numbers of donor T cells in conjunction with a putatively expanded myeloid lineage, providing a further rationale for the limitation of cell dose in allogeneic stem cell transplantation. (C) 2004 American Society for Blood and Marrow Transplantation.
Resumo:
The AP-2 transcription factor family is presumed to play an important role in the regulation of the keratinocyte squamous differentiation program; however, limited functional data are available to support this. In the present study, the activity and regulation of AP-2 were examined in differentiating human epidermal keratinocytes. We report that (1) AP-2 transcriptional activity decreases in differentiated keratinocytes but remains unchanged in differentiation-insensitive squamous cell carcinoma cell lines, (2) diminished AP-2 transcriptional activity is associated with a loss of specific DNA-bound AP-2 complexes, and (3) there is an increase in the ability of cytoplasmic extracts, derived from differentiated keratinocytes, to phosphorylate AP-2alpha and AP-2beta when cells differentiate. In contrast, extracts from differentiation-insensitive squamous cell carcinoma cells are unable to phosphorylate AP-2 proteins. Finally, the phosphorylation of recombinant AP-2alpha by cytosolic extracts from differentiated keratinocytes is associated with decreased AP-2 DNA-binding activity. Combined, these data indicate that AP-2 trans-activation and DNA-binding activity decrease as keratinocytes differentiate, and that this decreased activity is associated with an enhanced ability to phosphorylate AP-2alpha and beta.
Resumo:
Germline mutations of APC in patients with Turcot syndrome (colon cancer and medulloblastoma), was well as somatic mutations of APC, beta-catenin, and Axin in sporadic medulloblastomas (MBs) have shown the importance of WNT signaling in the pathogenesis of MB. A subset of children with MB have germline mutations of SUFU, a known inhibitor of Hedgehog signal transduction. A recent report suggested that murine Sufu can bind beta-catenin, export it from the nucleus, and thereby repress beta-catenin/T-cell factor (Tcf)-mediated transcription. We show that an MB-derived mutant of SUFU has lost the ability to decrease nuclear levels of beta-catenin, and cannot inhibit beta-catenin/Tcf-mediated transcription as compared to wild type SUFU. Our results suggest that loss of function of SUFU results in overactivity of both the Sonic Hedgehog, and the WNT signaling pathways, leading to excessive proliferation and failure to differentiate resulting in MB.
Resumo:
The poor response to immunotherapy in patients with multiple myeloma (MM) indicates that a better understanding of any defects in the immune response in these patients is required before effective therapeutic strategies can be developed. Recently we reported that high potency (CMRF44(+)) dendritic cells (DC) in the peripheral blood of patients with MM failed to significantly up-regulate the expression of the B7 co-stimulatory molecules, CD80 and CD86, in response to an appropriate signal from soluble trimeric human CD40 ligand. This defect was caused by transforming growth factor beta(1) (TGFbeta(1)) and interleukin (IL)-10, produced by malignant plasma cells, and the defect was neutralized in vitro with anti-TGFbeta(1). As this defect could impact on immunotherapeutic strategies and may be a major cause of the failure of recent trials, it was important to identify a more clinically useful agent that could correct the defect in vivo. In this study of 59 MM patients, the relative and absolute numbers of blood DC were only significantly decreased in patients with stage III disease and CD80 up-regulation was reduced in both stage I and stage III. It was demonstrated that both IL-12 and interferon-gamma neutralized the failure to stimulate CD80 up-regulation by huCD40LT in vitro. IL-12 did not cause a change in the distribution of DC subsets that were predominantly myeloid (CD11c+ and CDw123-) suggesting that there would be a predominantly T-helper cell type response. The addition of IL-12 or interferon-gamma to future immunotherapy trials involving these patients should be considered.
Resumo:
The role of the eukaryotic release factor 1 (eRF1) in translation termination has previously been established in yeast; however, only limited characterization has been performed on any plant homologs. Here, we demonstrate that cosuppression of eRF1-1 in Arabidopsis (Arabidopsis thaliana) has a profound effect on plant morphology, resulting in what we term the broomhead phenotype. These plants primarily exhibit a reduction in internode elongation causing the formation of a broomhead-like cluster of malformed siliques at the top of the inflorescence stem. Histological analysis of broomhead stems revealed that cells are reduced in height and display ectopic lignification of the phloem cap cells, some phloem sieve cells, and regions of the fascicular cambium, as well as enhanced lignification of the interfascicular fibers. We also show that cell division in the fascicular cambial regions is altered, with the majority of vascular bundles containing cambial cells that are disorganized and possess enlarged nuclei. This is the first attempt at functional characterization of a release factor in vivo in plants and demonstrates the importance of eRF1-1 function in Arabidopsis.
Resumo:
The nuclear localization of a number of growth factors, cytokine ligands and their receptors has been reported in various cell lines and tissues. These include members of the fibroblast growth factor (FGF), epidermal growth factor and growth hormone families. Accordingly, a number of nuclear functions have begun to emerge for these protein families. The demonstration of functional interactions of these proteins with the nuclear import machinery has further supported their functions as nuclear signal transducers. Here, we review the membrane- trafficking machinery and pathways demonstrated to regulate this cell surface to nucleus-trafficking event and highlight the many remaining unanswered questions. We focus on the FGF family, which is providing many of the clues as to the process of this unusual phenomenon.