Phosphorus in Finnish soils in the 1900s with particular reference to the acid ammonium acetate soil test

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

Table de transcodage des diagnostics : VESKA (version 1979) - ICD-9-CM

Travaux effectués dans le cadre de l'étude "Case Mix" menée par l'Institut universitaire de médecine sociale et préventive de Lausanne et le Service de la santé publique et de la planification sanitaire du canton de Vaud, en collaboration avec les cantons de Berne, Fribourg, Genève, Jura, Neuchâtel, Soleure, Tessin et Valais.

Factors Influencing Stability of Granular Base Course Mixes, Progress Report, HR-99, 1965

The problems of laboratory compaction procedures, the effect of gradation and mineralogy on shearing strength, and effect of stabilizing agents on shearing strength of granular base course mixes are discussed. For the materials tested, a suitable laboratory compaction procedure was developed which involves the use of a vibratory table to prepare triaxial test specimens. A computer program has been developed to facilitate the analysis of the test data of the effect of gradation and mineralogy on shearing strength of soils. The effects of the following materials have been selected for evaluation as stabilizing agents’ portland cement, sodium and calcium chloride, lime organic cationic waterproofer, and asphaltic materials.

Factors Influencing Stability of Granular Base Course Mixes, Progress Report, HR-99, 1964 (April)

The problems of laboratory compaction procedures, the effect of gradation and mineralogy on shearing strength, and effect of stabilizing agents on shearing strength of granular base course mixes are discussed. For the materials tested, a suitable laboratory compaction procedure was developed which involves the use of a vibratory table to prepare triaxial test specimens. A computer program has been developed to facilitate the analysis of the test data of the effect of gradation and mineralogy on shearing strength of soils. The effects of the following materials have been selected for evaluation as stabilizing agents’ portland cement, sodium and calcium chloride, lime organic cationic waterproofer, and asphaltic materials.

Factors Influencing Stability of Granular Base Course Mixes, Progress Report, HR-99, 1964 (November)

The problems of laboratory compaction procedures, the effect of gradation and mineralogy on shearing strength, and effect of stabilizing agents on shearing strength of granular base course mixes are discussed. For the materials tested, a suitable laboratory compaction procedure was developed which involves the use of a vibratory table to prepare triaxial test specimens. A computer program has been developed to facilitate the analysis of the test data of the effect of gradation and mineralogy on shearing strength of soils. The effects of the following materials have been selected for evaluation as stabilizing agents’ portland cement, sodium and calcium chloride, lime organic cationic waterproofer, and asphaltic materials.

Evaluation of a computer model to simulate water table response to subirrigation

The objective of this work was to evaluate the water flow computer model, WATABLE, using experimental field observations on water table management plots from a site located near Hastings, FL, USA. The experimental field had scale drainage systems with provisions for subirrigation with buried microirrigation and conventional seepage irrigation systems. Potato (Solanum tuberosum L.) growing seasons from years 1996 and 1997 were used to simulate the hydrology of the area. Water table levels, precipitation, irrigation and runoff volumes were continuously monitored. The model simulated the water movement from a buried microirrigation line source and the response of the water table to irrigation, precipitation, evapotranspiration, and deep percolation. The model was calibrated and verified by comparing simulated results with experimental field observations. The model performed very well in simulating seasonal runoff, irrigation volumes, and water table levels during crop growth. The two-dimensional model can be used to investigate different irrigation strategies involving water table management control. Applications of the model include optimization of the water table depth for each growth stage, and duration, frequency, and rate of irrigation.

Development of a Durability Test for Asphalts, May 1972

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.

Fertility life table of Trichogramma pretiosum and Trichogramma acacioi on eggs of Anagasta kuehniella at different temperatures

Species of the Trichogramma genus are among the most important ones for biological control. The objective of this research was to evaluate parasitism potential of two species of Trichogramma on eggs of Anagasta kuheniella through life fertility table, at temperatures between 15ºC and 35ºC. These species were collected in the State of Espírito Santo parasitising eggs of the avocado defoliator Nipteria panacea. Trichogramma pretiosum and T. acacioi showed adequate reproductive potential between 15ºC and 35ºC which indicates possibilities of using them in biological control programs in avocado plantations.

Effects of alternative sets of climatic predictors on species distribution models and associated estimates of extinction risk: a test with plants in an arid environment

Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.

Bruce Treadmill Test in Children : First Normal Values for Children from Western Europe : P67

Introduction: One of the main goals for exereise testing in children is evaluation of exercise capacity. There are many testing protocols, but the Bruce treadmill protocol is widely used among pediatrie cardiology centers. Thirty years ago, Cuming et al. were the first to establish normal values for children from North America (Canada) aged 4 to 18 years old. No data was ever published for children from Western Europe. Our study aimed to assess the validity of the normal values from Cuming et al. for children from Western Europe in the 21 st century. Methods: It is a retrospective cohort study in a tertiary care children's hospital. 144 children referred to our institution but finally diagnosed as having a normal heart underwent exercise stress testing using the Bruce protocol between 1999 and 2006. Data from 59 girls and 85 boys aged 6 to 18 were reviewed. Mean endurance time (ET) for each age category and gender was compared with the mean normal values fram Cumming et al by an unpaired t-test. Results: Mean ET increases with age until 15 years old in girls and then decreases. Mean endurance time increases continuouslY'from 6 to 18 years old in boys. The increase is more pronounced in boys than girls. In our study, a significant higher mean ET was found for boys in age categories 10 to 12, 13 to 15 and 16 to 18. No significant difference was found in any other groups. Conclusions: Some normal values from Cuming et al. established in 1978 for ET with the Bruce protocol are probably not appropriate any more today for children from Western Europe. Our study showed that mean ET is higher for boys from 10 to 18 years old. Despite common beliefs, cardiovascular conditioning doesn't seem yet reduced in children from Western Europe. New data for Bruce treadmill exercise. testing for healthy children, 4 to 18 years old, living in Western Europe are required. .

Stepwise evaluation of unexplained syncope in a large ambulatory population

La syncope est un symptôme clinique fréquent mais son origine demeure indéterminée jusque dans 60% des cas de patients admis dans un centre d'urgences. Le développement de consultations spécialisées de la syncope a considérablement modifié l'évaluation des patients avec une syncope inexpliquée en les orientant vers des stratégies d'investigations non-invasives, tels que le tilt-test, le massage du sinus carotidien et le test ^hyperventilation. Cependant, il existe peu de données dans 10 la littérature concernant dans la performance diagnostique réelle de ces tests fonctionnels.Notre travail de recherche porte sur l'analyse des données des 939 premiers patients adressés à la consultation ambulatoire de la syncope du CHUV pour l'investigation d'une syncope d'origine indéterminée. L'objectif de notre travail de thèse est 1) d'évaluer la performance diagnostique de l'algorithme de prise en charge standardisé et de ses différents tests pratiqués dans le cadre de notre 15 consultation et 2) de déterminer les caractéristiques cliniques communes des patients avec un diagnostic final de syncope d'origine rythmique ou vaso-vagale.Notre travail de thèse démontre qu'un algorithme de prise en charge standardisé basé sur des tests non-invasifs permet de déterminer 2/3 des causes de syncope initialement d'origine indéterminée. Par ailleurs, notre travail montre que des étiologies bénignes, telles que la syncope d'origine vaso- 20 vagale ou psychogène, représentent la moitié des causes syncopales alors que les arythmies cardiaques demeurent peu fréquentes. Finalement, notre travail démontre que l'absence de symptomatologie prodromique, en particulier chez les patients âgés avec une limitation fonctionnelle ou un allongement de la durée de l'onde Ρ à l'électrocardiogramme, suggère une syncope d'origine rythmique. Ce travail de thèse contribuera à optimaliser notre algorithme de prise 25 en charge standardisée de la syncope d'origine indéterminée et ouvre de nouvelles perspectives de recherche dans le développement de modèles basés sur des facteurs cliniques permettant de prédire les principales causes syncopales.