1000 resultados para développement sexuel normal
Resumo:
The objective of the present study was to determine the effects of retinoic acid on the growth of the mouse mammary cells HC11 and HC11ras, which are a model for in vitro breast cancer progression. The expression of the two classes (RARs and RXRs) of retinoic acid receptor mRNAs was determined by Northern blot analysis. Receptor functional integrity was determined by testing whether RAR ß mRNA could be induced by retinoic acid. The effects of a 72-h exposure to 50 µM 13-cis retinoic acid on HC11 and HC11ras cell proliferation and HC11 cell differentiation were investigated by flow cytometric cell cycle analysis, and by determination of ß-casein mRNA expression, respectively. The possibility that retinoic acid would induce the expression of the vitamin D receptor and synergize with vitamin D, a known inhibitor of HC11 cell growth, was also investigated. HC11 cells expressed higher mRNA levels of both RAR a and RAR g when compared to HC11ras cells. In contrast, RAR ß, as well as RXR a, ß and g expression was low in both HC11 and HC11ras cells. In addition, RAR ß mRNA was induced by retinoic acid treatment in both cells. In spite of these observations, no effects were seen on cell proliferation or differentiation upon exposure to retinoic acid. Neither vitamin D receptor induction nor synergy with vitamin D on growth inhibition was observed. We conclude that the RAR expression profile could be related to the transformed state in HC11ras cells and that the retinoic acid resistance observed merits further investigation.
Resumo:
The actin cytoskeleton is a dynamic structure that determines cell shape. Actin turnover is mandatory for migration in normal and malignant cells. In epithelial cancers invasion is frequently accompanied by epithelial to mesenchymal transition (EMT). In EMT, cancer cells acquire a migratory phenotype through transcriptional reprogramming. EMT requires substantial re-organization of actin. During the past decade, new actin regulating proteins have been discovered. Among these are members of the formin family. To study formin expression in tissues and cells, antibodies for detection of formin proteins FMNL1 (Formin-like protein 1), FMNL2 (Formin-like protein 2) and FHOD1 (Formin homology 2 domain containing protein 1) were used. The expression of formins was characterized in normal tissues and selected cancers using immunohistochemistry. The functional roles of formins were studied in cancer cell lines. We found that FMNL2 is widely expressed. It is a filopodial component in cultured melanoma cells. In clinical melanoma, FMNL2 expression has prognostic significance. FHOD1 is a formin expressed in mesenchymal cell types. FHOD1 expression is increased in oral squamous cell carcinoma (SCC) EMT. Importantly, FHOD1 participates in invasion of cultured oral SCC cells. FMNL1 expression is low in normal epithelia, but high in leukocytes and smooth muscle cells. Expression of FMNL1 can be found in carcinoma; we detected FMNL1 expressing cells in basal type of breast cancer. Our results indicate that formins are differentially expressed in normal tissues and that their expression may shift in cancer. Functionally FMNL2 and FHOD1 participate in processes related to cancer progression. Studying formins is increasingly important since they are potential drug targets.
Resumo:
The use of bovine pericardium as a urethral patch to substitute a ventral segment of canine urethras was studied. Healing, epithelial growth, urethral permeability, fistulas, and calcification were analyzed. Thirty male mongrel dogs of medium and large size underwent resection of a ventral segment of the medial urethra measuring 2.0 x 0.5 cm, which was replaced with a bovine pericardium graft, treated with buffered glutaraldehyde and preserved in formaldehyde. Two running sutures of polygalactin 5-0 were applied, one on each side of the patch. The corpus spongiosum was closed with uninterrupted suture and the skin with interrupted suture of polygalactin 5-0. Six months later, the animals were examined and sacrificed under anesthesia. Retrograde urethrograms showed that the urethral healing was complete in six of the 30 animals, without stenosis, fistulas or dilations. Microscopic examination showed complete epithelization of these six urethras. The remaining 24 animals presented urethrocutaneous fistulas without stenosis, demonstrated by urethral catheterism using a 10-Fr plastic catheter. These data show that a successful urethral reconstruction of the penile urethra was possible in only 20% of the operated animals. Infection and leakage may be the cause of the urethrocutaneous fistulas present in 80% of cases. Further studies are necessary to determine whether such fistulas are avoidable. If they are, the bovine pericardium may well be an option in the treatment of urethral lesions in dogs.
Resumo:
Panic disorder is thought to involve dysfunction in the septohippocampal system, and the presence of a cavum septum pellucidum might indicate the aberrant development of this system. We compared the prevalence and size of cavum septum pellucidum in 21 patients with panic disorder and in 21 healthy controls by magnetic resonance imaging. The length of the cavum septum pellucidum was measured by counting the number of consecutive 1-mm coronal slices in which it appeared. A cavum septum pellucidum of >6 mm in length was rated as large. There was no significant difference in the proportion of patients (16 of 21 or 76.2%) and controls (18 of 21 or 85.7%) with a cavum septum pellucidum (P = 0.35, Fisher's exact test, one-tailed), and no members of either group had a large cavum septum pellucidum. The mean cavum septum pellucidum rating in the patient and control groups was 1.81 (SD = 1.50) and 2.09 (SD = 1.51), respectively. There were also no significant differences between groups when we analyzed cavum septum pellucidum ratings as a continuous variable (U = 196.5; P = 0.54). Across all subjects there was a trend towards a higher prevalence of cavum septum pellucidum in males (100%, 10 of 10) than females (75%, 24 of 32; P = 0.09, Fisher's exact test, one-tailed). Thus, we conclude that, while panic disorder may involve septo-hippocampal dysfunction, it is not associated with an increased prevalence or size of the cavum septum pellucidum.
Resumo:
Dysregulation of the skin immune system (SIS) could explain the high prevalence of skin disorders in HIV+ individuals. The present study was carried out to determine whether alterations in the cell population of SIS and epidermal immunoactivation occur in the normal skin of HIV+ individuals. Forty-five biopsies were taken from the normal upper arm skin of 45 HIV+ patients and of 15 healthy controls. HIV+ individuals were divided into three categories according to their CD4 cell blood count (<200, 200-499 and ³500/µl). Hematoxylin-eosin was used to stain tissue sections for morphological analysis and immunohistochemistry was used for the evaluation of the frequency of macrophages, Langerhans cells, and CD lymphocyte subsets. In addition, semiquantitative analysis of LFA-1, ICAM-1 and HLA-DR was determined in epidermal cells. Macrophages, Langerhans cells, and CD lymphocyte subsets did not differ significantly between any of the patient categories and the control group. When all HIV+ individuals were compared as a group to the control group, a significant increase in dermal CD8+ T lymphocytes (P < 0.01) and lower CD4-CD8 ratios (P < 0.01) were observed in the HIV+ individuals. Epidermal ICAM-1 and HLA-DR expression was negative in both HIV+ and normal skin biopsies. No evidence of a depletion of the SIS population or of epidermal immunoactivation in normal skin from HIV+ individuals was demonstrable, suggesting that alterations in the central immune system are not necessarily reflected in the SIS of HIV-infected patients.
Resumo:
Several primary immunodeficiency diseases affecting the interleukin 12/interferon gamma (IFN-gamma) pathway have been identified, most of them characterized by recurrent and protracted infections produced by intracellular microorganisms, particularly by several species of mycobacteria. In the present study we analyzed the expression of IFN-gamma receptor (IFN-gammaR) and signal transducer and activator of transcription 1 (STAT-1) in 4 children with Mycobacterium tuberculosis infection of uncommon clinical presentation. These molecules were evaluated by flow cytometry and Western blotting in B cells transformed with Epstein-Barr virus and mutations were scanned by single-strand conformational polymorphisms and DNA sequencing. The expression of IFN-gammaR1 was normal in all 4 patients. The genetic analysis of IFN-gammaR1 and IFN-gammaR2 coding sequences did not reveal any mutation. The expression of the STAT-1 molecule was similar in patients and healthy controls; however, when the phosphorylation of this transcription factor in response to IFN-gamma activation was evaluated by Western blot, a significant lower signal was evident in one patient. These data indicate that there are no alterations in the expression or function of the IFN-gammaR chains in these patients. However, the low level of STAT-1 phosphorylation found in one of these patients might be explained by a defect in one of the molecules involved in the signal transduction pathway after IFN-gamma interacts with its receptor. In the other three patients the inability to eliminate the mycobacteria may be due to a defect in another effector mechanism of the mononuclear phagocytes.
Resumo:
In the present study we determined the effect of chronic diet supplementation with n-3 PUFA on renal function of healthy and cachectic subjects by providing fish oil (1 g/kg body weight) to female rats throughout pregnancy and lactation and then to their offspring post-weaning and examined its effect on renal function parameters during their adulthood. The animals were divided into four groups of 5-10 rats in each group: control, control supplemented with fish oil (P), cachectic Walker 256 tumor-bearing (W), and W supplemented with fish oil (WP). Food intake was significantly lower in the W group compared to control (12.66 ± 4.24 vs 25.30 ± 1.07 g/day). Treatment with fish oil significantly reversed this reduction (22.70 ± 2.94 g/day). Tumor growth rate was markedly reduced in the P group (16.41 ± 2.09 for WP vs 24.06 ± 2.64 g for W). WP group showed a significant increase in mean glomerular filtration rate compared to P and control (1.520 ± 0.214 ml min-1 kg body weight-1; P < 0.05). Tumor-bearing groups had low urine osmolality compared to control rats. The fractional sodium excretion decreased in the W group compared to control (0.43 ± 0.16 vs 2.99 ± 0.87%; P < 0.05), and partially recovered in the WP group (0.90 ± 0.20%). In summary, the chronic supplementation with fish oil used in this study increased the amount of fat in the diet by only 0.1%, but caused remarkable changes in tumor growth rate and cachexia, also showing a renoprotective function.
Resumo:
Subclinical hypothyroidism (SHT) is a disease for which exact therapeutic approaches have not yet been established. Previous studies have suggested an association between SHT and coronary heart disease. Whether this association is related to SHT-induced changes in serum lipid levels or to endothelial dysfunction is unclear. The aim of this study was to determine endothelial function measured by the flow-mediated vasodilatation of the brachial artery and the carotid artery intima-media thickness (IMT) in a group of women with SHT compared with euthyroid subjects. Triglycerides, total cholesterol, HDL-C, LDL-C, apoprotein A (apo A), apo B, and lipoprotein(a) were also determined. Twenty-one patients with SHT (mean age: 42.4 ± 10.8 years and mean thyroid-stimulating hormone (TSH) levels: 8.2 ± 2.7 µIU/mL) and 21 euthyroid controls matched for body mass index, age and atherosclerotic risk factors (mean age: 44.2 ± 8.5 years and mean TSH levels: 1.4 ± 0.6 µIU/mL) participated in the study. Lipid parameters (except HDL-C and apo A, which were lower) and IMT values were higher in the common carotid and carotid bifurcation of SHT patients with positive serum thyroid peroxidase antibodies (TPO-Ab) (0.62 ± 0.2 and 0.62 ± 0.16 mm for the common carotid and carotid bifurcation, respectively) when compared with the negative TPO-Ab group (0.55 ± 0.24 and 0.58 ± 0.13 mm, for common carotid and carotid bifurcation, respectively). The difference was not statistically significant. We conclude that minimal thyroid dysfunction had no adverse effects on endothelial function in the population studied. Further investigation is warranted to assess whether subclinical hypothyroidism, with and without TPO-Ab-positive serology, has any effect on endothelial function.
Resumo:
Thromboelastography (TEG®) provides a functional evaluation of coagulation. It has characteristics of an ideal coagulation test for trauma, but is not frequently used, partially due to lack of both standardized techniques and normal values. We determined normal values for our population, compared them to those of the manufacturer and evaluated the effect of gender, age, blood type, and ethnicity. The technique was standardized using citrated blood, kaolin and was performed on a Haemoscope 5000 device. Volunteers were interviewed and excluded if pregnant, on anticoagulants or having a bleeding disorder. The TEG® parameters analyzed were R, K, α, MA, LY30, and coagulation index. All volunteers outside the manufacturer’s normal range underwent extensive coagulation investigations. Reference ranges for 95% for 118 healthy volunteers were R: 3.8-9.8 min, K: 0.7-3.4 min, α: 47.8-77.7 degrees, MA: 49.7-72.7 mm, LY30: -2.3-5.77%, coagulation index: -5.1-3.6. Most values were significantly different from those of the manufacturer, which would have diagnosed coagulopathy in 10 volunteers, for whom additional investigation revealed no disease (81% specificity). Healthy women were significantly more hypercoagulable than men. Aging was not associated with hypercoagulability and East Asian ethnicity was not with hypocoagulability. In our population, the manufacturer’s normal values for citrated blood-kaolin had a specificity of 81% and would incorrectly identify 8.5% of the healthy volunteers as coagulopathic. This study supports the manufacturer’s recommendation that each institution should determine its own normal values before adopting TEG®, a procedure which may be impractical. Consideration should be given to a multi-institutional study to establish wide standard values for TEG®.
Resumo:
Micro-ribonucleic acids (microRNAs) are small molecules containing 20-23 nucleotides. Despite their small size, it is likely that almost every cellular process is regulated by them. Moreover, aberrant microRNA expression has been involved in the development of various diseases, including cancer. Although many data are available about the role of microRNAs in various lymphoproliferative disorders, their impact on the development of acute lymphoblastic leukemia of T-cell progenitors is largely unknown. In this review, we present recent information about how specific microRNAs are expressed and regulated during malignant T-lymphopoiesis and about their role during normal hematopoiesis.
Resumo:
Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.
Resumo:
Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500.
Resumo:
The liver is one of the target organs damaged by septic shock, wherein the spread of endotoxins begins. This study aimed to investigate the effects of exogenous normal lymph (ENL) on lipopolysaccharide (LPS)-induced liver injury in rats. Male Wistar rats were randomly divided into sham, LPS, and LPS+ENL groups. LPS (15 mg/kg) was administered intravenously via the left jugular vein to the LPS and LPS+ENL groups. At 15 min after the LPS injection, saline or ENL without cell components (5 mL/kg) was administered to the LPS and LPS+ENL groups, respectively, at a rate of 0.5 mL/min. Hepatocellular injury indices and hepatic histomorphology, as well as levels of P-selectin, intercellular adhesion molecule 1 (ICAM-1), myeloperoxidase (MPO), and Na+-K+-ATPase, were assessed in hepatic tissues. Liver tissue damage occurred after LPS injection. All levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in plasma as well as the wet/dry weight ratio of hepatic tissue in plasma increased. Similarly, P-selectin, ICAM-1, and MPO levels in hepatic tissues were elevated, whereas Na+-K+-ATPase activity in hepatocytes decreased. ENL treatment lessened hepatic tissue damage and decreased levels of AST, ALT, ICAM-1, and MPO. Meanwhile, the treatment increased the activity of Na+-K+-ATPase. These results indicated that ENL could alleviate LPS-induced liver injury, thereby suggesting an alternative therapeutic strategy for the treatment of liver injury accompanied by severe infection or sepsis.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.