Reactive oxygen species-dependent mechanisms of N-(4-hydroxyphenyl)retinamide (4HPR)-induced apoptosis in human carcinoma cells

4HPR is a synthetic retinoid that has shown chemopreventive and therapeutic efficacy against premalignant and malignant lesions including oral leukoplakia, ovarian and breast cancer, and neuroblastoma. 4HPR induces apoptosis in various cancer cells and production of reactive oxygen species (ROS) has been suggested as a possible cause underlying these effects. However, the mechanisms governing these effects by 4HPR are not fully elucidated. In this study, we explored the mechanisms of 4HPR-induced ROS increase and apoptosis in human cancer cells. ^ First, we identified genes modulated by 4HPR using oligonucleotide gene expression arrays and found that they fall into specific functional canonical pathways and gene networks using Ingenuity Pathways Analysis®. Further analysis has shown that 4HPR induced up-regulation of Endoplasmic Reticulum (ER)-related genes such as Heat shock proteins 70 and 90 and the transcriptional factor, GADD153. These findings were validated using quantitative real-time PCR. ^ Second, we found that 4HPR induced extensive ER stress evidenced by dilation of the ER and endoribonuclease-mediated splicing and activation of the transcriptional factor, XBP-1. In addition, 4HPR induced the up-regulation of various ER stress-related genes and their protein products, as well as cleavage and activation of the ER specific Caspase-4. Concomitantly with XBP-1 splicing, all of these effects were dependent on ROS generation by 4HPR. Furthermore, chemical inhibition and RNA interference studies revealed a novel pro-apoptotic role for HSP70/A1A in 4HPR-mediated apoptosis. ^ Third, we observed rapid activation of the small GTPase Rac by 4HPR which was upstream of ROS generation. Inhibition of Rac activity or silencing of its expression by RNA interference inhibited ROS generation and apoptosis induction by 4HPR. siRNA targeting PAK1 and expression of a dominant negative Rac, decreased 4HPR-mediated ROS generation, while expression of a constitutive active Rac increased basal and 4HPR-induced ROS generation and PARP cleavage. Furthermore, metastatic cancer cells exhibited higher Rac activation, ROS generation, and cell growth inhibition due to 4HPR exposure compared to their primary cancer cell counterparts. ^ These findings provide novel insights into 4HPR-mediated ROS generation and apoptosis induction and support the use of ROS inducing agents such as 4HPR against metastatic cancer cells. ^

Ligand-stimulated internalization of a Dictyostelium discoideum G protein-coupled cAMP receptor

The social amoeba, Dictyostelium discoideum, undergoes a remarkable starvation-induced program of development that transforms a population of unicellular amoebae into a fruiting body composed of resistant spores suspended on a stalk. During this development, secreted cAMP drives chemotaxis of the amoebae, leading to their aggregation, and subsequent differentiation and morphogenesis. Four sequentially expressed G protein-coupled receptors (GPCRs) for cAMP play critical roles in this process. The first of these, cAR1, is essential for aggregation as it mediates chemotaxis as well as the propagation of secreted cAMP waves throughout aggregating populations. Ligand-induced internalization has been shown to regulate a variety of GPCRs. However, little was known at the outset of this study about the role of internalization in the regulation of cAR1 function or, for that matter, in developmental systems in general. For this study, cAMP-induced cAR1 internalization was assessed by measuring (1) the reduction of cell surface binding sites for [ 3H]cAMP and (2) the redistribution of YFP-tagged receptors to the cell's interior, cAMP was found to induce little or no loss of ligand binding (LLB) in vegetative cells. However, the ability to induce LLB increased progressively over the initial 6 hrs of development, reaching ∼70% in cells undergoing aggregation. Despite these reductions in surface binding, detectable cAR1-YFP redistribution could be induced by cAMP only after the cells reached the mound stage (10 hrs) and was found to occur naturally by the ensuing slug stage (18 hrs). Site-directed substitution of a cluster of 5 serines in the receptor's cytoplasmic tail that was previously shown to be the principal site of cAMP-induced cAR1 phosphorylation impaired both LLB and receptor redistribution and furthermore resulted in mound-stage developmental arrest, suggesting that phosphorylation of cAR1 is a prerequisite for its internalization and that cAR1 internalization is required for post-aggregative development. To assess the involvement of clathrin mediated endocytosis, Dictyostelium cells lacking the clathrin light chain gene (clc-) or either of two dynamin genes were examined and found to be defective in LLB and, in the case of clc- cells, also cAR1 redistribution and turnover. Furthermore, cAR1 overexpression in clc- cells (like the serine mutant in wild-type cells) promoted developmental arrest in mounds. The mound-arrest phenotype was also recapitulated in a wild-type background by the specific expression of cAR1 in prestalk cells (but not prespore cells), suggesting that development depends critically on internalization and clearance of cAR1 from these cells. Persistent cAR1 expression following aggregation was found to be associated with aberrant expression of prestalk and prespore genes, which may adversely affect development in the prestalk cell lineage. The PI3 kinase-TORC2 signal transduction pathway, known to be important for Dictyostelium chemotaxis and internalization of yeast pheromone receptors, was examined using chemical inhibitors and null cells and found to be necessary for cAR1 internalization. In conclusion, cAR1 was shown to be similar to other GPCRs in that its internalization depends on phosphorylation of cytoplasmic domain serines, utilizes clathrin and dynamin, and involves the TORC2 complex. In addition, the findings presented here that cAR1 internalization is both developmentally regulated and required for normal development represent a novel regulatory paradigm that might pertain to other GPCRs known to play important roles in the development of humans and other metazoans. ^

Emerging roles for the double strand break repair protein 53BP1 in transcriptional regulation

Disruption of the mechanisms that regulate cell-cycle checkpoints, DNA repair, and apoptosis results in genomic instability and often leads to the development of cancer. In response to double stranded breaks (DSBs) as induced by ionizing radiation (IR), generated during DNA replication, or through immunoglobulin heavy chain (IgH) rearrangements in T and B cells of lymphoid origin, the protein kinases ATM and ATR are central players that activate signaling pathways leading to DSB repair. p53 binding protein 1 (53BP1) participates in the repair of DNA double stranded breaks (DSBs) where it is recruited to or near sites of DNA damage. In addition to its well established role in DSB repair, multiple lines of evidence implicate 53BP1 in transcription which stem from its initial discovery as a p53 binding protein in a yeast two-hybrid screen. However, the mechanisms behind the role of 53BP1 in these processes are not well understood. ^ 53BP1 possesses several motifs that are likely important for its role in DSB repair including two BRCA1 C-terminal repeats, tandem Tudor domains, and a variety of phosphorylation sites. In addition to these motifs, we identified a glycine and arginine rich region (GAR) upstream of the Tudor domains, a sequence that is oftentimes serves as a site for protein arginine methylation. The focus of this project was to characterize the methylation of 53BP1 and to evaluate how methylation influenced the role of 53BP1 as a tumor suppressor. ^ Using a variety of biochemical techniques, we demonstrated that 53BP1 is methylated by the PRMT1 methyltransferase in vivo. Moreover, GAR methylation occurs on arginine residues in an asymmetric manner. We further show that sequences upstream of the Tudor domains that do not include the GAR stretch are sufficient for 53BP1 oligomerization in vivo. While investigating the role of arginine methylation in 53BP1 function, we discovered that 53BP1 associates with proteins of the general transcription apparatus as well as to other factors implicated in coordinating transcription with chromatin function. Collectively, these data support a role for 53BP1 in regulating transcription and provide insight into the possible mechanisms by which this occurs. ^

Identification of essential apoptotic genes in Drosophila

Apoptosis is a normal physiological cell suicide process which is essential for tissue homeostasis and normal development of metazoans. Misregulation of apoptosis is associated with many developmental defects and human diseases. The genes involved in the regulation and execution of apoptosis are highly conserved in humans and flies. Caspases are the executioners of cell suicide. Because of the unavailability of specific fly mutants, the developmental function of many caspase genes and genetic relationship between caspases and apoptotic components were undefined in Drosophila. We isolated several mutant alleles of the initiator caspase gene dronc, the effector casase drICE, and the Mediator component Cyclin C from the GMR-hid eyFLP/FRT screens which is designed to isolate mutants of recessive cell death genes in Drosophila melanogaster. Characterization of these mutants defined that they are essential for developmental cell death in Drosophila. dronc is required for most, but not all, cell death in Drosophila. drICE is required for apoptosis in many cells and it shares redundancy with another effector caspase gene, dcp-1, in a subset of cells in Drosophila. The genetic relationship between caspases and other apoptotic components was established through mutant analysis. We found that the pro-apoptotic protein Hid induces transcription of the initiator caspase gene dronc and the GMR-induced dronc transcripts are dependent on activated effector casapses, revealing a novel regulatory mechanism to promote caspase activity in Drosophila. Cyclin C and its kinase partner Cdk8 are required for prompt transcriptional induction of dronc in cell killing contexts. In short, we define the essential pro-apoptoic function of dronc, drICE, and Cyclin C in Drosophila and reveal a novel mechanism for regulation of dronc transcription. In the long run, these studies will help us decipher the complicated regulatory mechanism of cell death in humans. ^

GMZ27 is a new organic arsenic derivative with anti-leukemic activity, via the induction of reactive oxygen species through NADPH oxidase and mitochondrial pathway that lead to leukemia cell apoptosis

Arsenic trioxide (ATO) is an inorganic arsenic derivative that is very effective against relapsed acute promyelocytic leukemia. It is being investigated as therapy for other cancers, but the risk/benefit ratio is questionable due to significant side effects. In contrast, organic arsenic derivatives (OAD) are known to be much less toxic than ATO. Based on high activity, we selected GMZ27 (dipropil-s-glycerol arsenic) for further study and have confirmed its potent activity against human acute leukemia cell lines. This anti-leukemic activity is significantly higher than that of ATO. Both in vivo and in vitro tests have shown that GMZ27 is significantly less toxic to normal bone marrow mononuclear cells and normal mice. Therefore, further study of the biological activity of GMZ27 was undertaken. ^ GMZ27, in contrast to ATO, can only marginally induce maturation of leukemic cells. GMZ27 has no effect on cell cycle. The anti-leukemic activity of GMZ27 against acute myeolocytic leukemia cells is not dependent upon degradation of PML-RARα fusion protein. GMZ27 causes dissipation of mitochondrial transmembrane potential, cleavage of caspase 9, caspase 3 activation. Further studies indicated that GMZ27 induces intracellular reactive oxygen species (ROS) production, and modification of intracellular ROS levels had profound effect on its potential to inhibit proliferation of leukemic cells. Therefore ROS production plays a major role in the anti-leukemic activity of GMZ27. ^ To identify how GMZ27 induces ROS, our studies focused on mitochondria and NADPH oxidase. The results indicated that the source of ROS generation induced by GMZ27 is dose dependent. At the low dose (0.3 uM) GMZ27 induces NADPH oxidase activity that leads to late ROS production, while at the high dose (2.0 uM) mitochondria function is disrupted and early ROS production is induced leading to dramatic cell apoptosis. Therefore, late, ROS production can be detected in mitochondria are depleted Rho-0 cells. Our work not only delineates a major biologic pathway for the anti-leukemic activity of GMZ27, but also discusses possible ways of enhancing the effect by the co-application of NADPH oxidase activator. Further study of this interaction may lead to achieving better therapeutic index.^

Control of the master virulence regulatory gene atxA in Bacillus anthracis

Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Inhibitor of cytochrome c messenger RNA -protein interaction in stimulated rat skeletal muscle

The purpose of this work was to examine the possible mechanisms for the regulation of cytochrome c gene expression in response to increased contractile activity in rat skeletal muscle. The working hypothesis was that increased contractile activity enhances cytochrome c gene expression through a cis-element. A 110% increase in cytochrome c mRNA concentration was observed in tibialis anterior (TA) muscle after 9 days of chronic stimulation. Similar difference (120%) exists between soleus (SO) muscle of higher contractile activity and white vastus lateralis (WV) muscle of lower contractile activity. These results suggest that the endogenous cytochrome c gene expression is regulated by contractile activity. Cytochrome c-reporter genes were injected into skeletal muscles to identify the cis-element that is responsible for the regulation. Although the data was inconclusive, part of it suggested the importance of the 3$\sp\prime$-untranslated region (3$\sp\prime$-UTR) in mediating the response to increased contractile activity.^ RNA gel mobility shift (GMSA) and ultraviolet (UV) cross-linking assays revealed specific RNA-protein interaction in a 50-nucleotide region of the 3$\sp\prime$-UTR in unstimulated TA muscle. Computer analysis predicted a stem-loop structure of 17 nucleotides, which provides a structural basis for RNA-protein interaction. These 17 nucleotides are 100% conserved among rat, mouse and human cytochrome c genes and their 13 pseudogenes, suggesting a functional role for this region. The RNA-protein interaction was significantly less in highly active SO muscle than in inactive WV muscle and was dramatically decreased in stimulated TA muscle due to a protein inhibitor(s) associated with ribosome. It is possible that cytochrome c mRNAs undergoing translation are subject to a compartmentalized regulatory influence.^ The conclusion from these results is that increases in contractile activity induce or activate a protein inhibitor(s) associated with ribosome in rat skeletal muscle. The inhibitor decreases RNA-protein interaction in the 3$\sp\prime$-UTR of cytochrome c mRNA, which may result in increased mRNA stability and/or translation. ^

The structural and functional relationship of the p53 tumor suppressor protein

The tumor-suppressing function of p53 can be affected in a variety of manners. Here, we describe a novel mechanism of transformation by mutant p53. Previously, it had been believed that mutant p53 molecules transform cells by oligomerizing with wild-type p53 and inactivating it. However, we demonstrated that there exists an additional mechanism of inactivation of p53 available to p53 mutants. It involves sequestration of cofactors necessary to p53, and subsequent interruption of its transactivation and tumor suppression functions. The p53 amino or carboxyl termini, known to interact with a large number of cellular factors, can affect wild-type p53 in this manner. Although they are unable to oligomerize with wild-type p53, they transform cells containing p53, and inhibit its transactivation ability. In addition, they interrupt growth suppression by p53, but not RB, confirming that they specifically affect p53 function, rather than having a general growth-stimulatory phenomenon. Also, we have cloned a p53 tumor mutation which results in expression of the amino terminus of p53. This provides a means to study the factor-sequestration transforming mechanism in vivo. Additionally, we found that the published sequence of the mdm2 gene is in error. mdm2 is a gene intimately involved with p53, blocking its ability to transform cells. Finally, previous data had established the influence of cell-cycle status on p53 function. In growth-arrested cells, wild-type p53 expressed by a transgene cannot activate transcription, but if these cells are forced to cycle by addition of cyclin E, p53 once again becomes functional. In this study, we extend these findings by examining only those cells successfully transfected, using fluorescence-activated cell sorting. Our results support the previous data, that cyclin E pushes growth-arrested cells back into the cell cycle. In summary, we have demonstrated the potential importance of cofactor association and protein modification to the abilities of p53 to cause transcription activation and repression, inhibition of DNA replication and induction of DNA repair, and initiation of cell-cycle arrest and apoptosis. Further elucidation of these processes and their roles in tumor suppression will prove fascinating indeed. ^

Regulation of apoptosis during the pathogenesis of non -melanoma skin cancer

Previous studies from our lab have shown distinctive patterns of expression of bcl-2 gene family members in human nonmelanoma skin cancer (NMSC). To further evaluate the significance of these observations and to study the effects of cell death deregulation during skin carcinogenesis, we generated a transgenic mouse model (HK1.bcl-2) using the human keratin 1 promoter to target the expression of a human bcl-2 minigene to the epidermis. Transgenic protein expression was confirmed in all the layers of the epidermis except the stratum corneum using immunohistochemistry. Multifocal epidermal hyperplasia, without associated hyperkeratosis, was observed in newborn HK1.bcl-2 mice. Immunofluorescence staining using monoclonal antibodies specific for a variety of differentiation markers revealed aberrant expression of keratin 6 (K6) in the transgenic epidermis. Epidermal proliferative indexes, assessed by anti-BrdUrd immunofluorescence staining, were similar in control and transgenic newborn mice, but suprabasal proliferating cells were seen within the hyperplastic areas of the transgenic mouse skin. Spontaneous apoptotic indices of the epidermis were similar in both control and HK1.bcl-2 transgenic newborn mice, however, after UV-B irradiation, the number of "sunburn cells" was significantly higher in the control compared to the HK1.bcl-2 transgenic animals.^ Adult HK1.bcl-2 and control littermate mice were used in UV-B and chemical carcinogenesis protocols including DMBA + TPA. UV-B irradiated control and HK1.bcl-2 mice had comparable incidence of tumors than the controls, but the mean latency period was significantly shorter in the HK1.bcl-2 transgenic. Both control and transgenic animals included in chemical carcinogenesis protocols required application of both the initiating (DMBA) and promoting (TPA) agents to develop tumors. The frequency, number, and latency of tumor formation was similar in both groups of animals, however, HK1.bcl-2 mice exhibited a rate of conversion from benign papilloma to carcinoma 2.5 times greater than controls.^ Similar carcinogenesis experiments were performed using newborn mice. HK1.bcl-2 mice treated with UV-B plus TPA have a three fold greater incidence of tumor formation compared to controls littermates. HK1.bcl-2 transgenic animals also exhibited a shorter latency for papilloma formation when treated with DMBA plus TPA.^ HK1.bcl-2/v-Ha-ras double transgenic mice shared phenotypic features of both HK1.v-Ha-ras and HK1.bcl-2 transgenic mice, and exhibited focal areas of augmented hyperplasia. These double transgenic mice were susceptible to tumor formation by treatment with TPA alone.^ Cultures of primary keratinocytes were established from control, HK1.bcl-2, HK1.Ha-ras, and HK1.bcl-2/v-Ha-ras newborn mice. Cell viability was determined after exposure of the cells to UV-B irradiation, DMBA, TPA, or TGF-$\beta$1. Internucleosomal DNA fragmentation ("ladders") and morphological cellular changes compatible with apoptotic cell death were observed after the application of all these agents. HK1.bcl-2 keratinocytes were resistant to cell death induction by all of these agents except TGF-$\beta$1. HK1.Ha-ras cells had a higher spontaneous rate of cell death which could be compensated by co-expression of bcl-2.^ These findings suggest that bcl-2 dependent cell death suppression may be an important component of multistep skin carcinogenesis. ^

Apoptosis and the molecular complementation of bcl-2, myc and p53 in multistep lymphomagenesis

Follicular lymphoma is the most common lymphoid malignancy in humans. The bcl-2 transgenic mice, which mimic the human follicular lymphoma, initially exhibit a polyclonal hyperplasia due to the overriding of apoptosis by deregulated bcl-2. After a latency period of 15 month 20% of the animals developed clonal lymphomas. Approximately, 50% of these high grade lymphomas presented chromosomal translocations involving c-myc, suggesting that deregulation of this gene is important in the complementation with bcl-2. E$\mu$-myc x bcl-2 double transgenic mice were generated to assess the ability of this two genes to complement in an in vivo system. The double transgenic mice presented a shortened latency (3-4 weeks) and higher incidence of tumor development. Quantification of the extent of programmed cell death indicated that bcl-2 can abrogate the high rate of apoptotic cell death that results from myc deregulation. Bcl-2-Ig, E$\mu$-myc, and bcl-2/E$\mu$-myc lymphomas were examined using PCR-SSCP to detect the presence of p53 mutations in exons 5-9. A high incidence of p53 mutations in E$\mu$-myc lymphomas suggested that inactivating lesions of p53 may represent an important step in the genetic complementation of c-myc in lymphomagenesis. Surprisingly, p53 mutations were quite uncommon in bcl-2 lymphomas suggesting that inactivating mutations of p53 and overexpression of bcl-2 may not cooperate in lymphoma progression. To assess this question, we generated mice that contained a deregulated bcl-2 gene and were nullizygous for p53 (p53KO). No reduction in the tumor latency was observed in the p53KO/bcl-2-Ig hybrid mice when compared with p53 KO mice. Using splenic mononuclear cells isolated from p53KO mice and bcl-2 transgenic mice we demonstrated that bcl-2 suppresses p53 mediated apoptosis in response to DNA damage initiated by $\gamma$-radiation even though p53 protein is induced normally in the bcl-2 overexpressing cells. Western analysis of the expression of p53 target proteins after $\gamma$-radiation showed a correlation between the p53-dependent induction of bax protein after radiation and the ability of p53 to mediate apoptosis. ^

Modulation of BCL-X$\sb{\rm L}$ is a critical determinant of c-myc induced apoptosis

The fine balance between proliferation and apoptosis plays a primary role in carcinogenesis. Proto-oncogenes that induce both proliferation and apoptosis provide a powerful inbuilt system to inhibit clonal expansion of cells with high proliferation rates. This provides a restraint to the development of neoplasms. C-myc expressing cells undergo apoptosis in low serum by an unknown mechanism. Several lines of evidence suggested that c-myc induces apoptosis by a transcriptional mechanism. However, the target genes of this program have not been fully defined. Protein synthesis inhibitors induce apoptosis in c-myc over-expressing cells at high serum levels suggesting that inhibition of synthesis of a survival factor may induce apoptosis. We show that the expression of c-myc directly correlates with an increase in the level of a survival protein, bcl-$\rm x\sb{L},$ and a decrease in the pro-apoptotic protein, bax, at both the protein and mRNA level. Furthermore, a significant decrease of the bcl-$\rm x\sb{L}$ protein levels is observed under low serum conditions. In order to investigate the mechanism of regulation of bcl-$\rm x\sb{L}$ and bax by c-myc, the bcl-x and bax promoters were cloned, sequenced and shown to contain c-myc binding sites. The chloramephenicol acetyl transferase (CAT) reporter assay was used to demonstrate activation of the bcl-x promoter by increasing levels of c-myc when co-transfected in COS cells. The bax promoter was also shown to be transrepressed in c-myc expressing cells. The role of bcl-$\rm x\sb{L}$ in apoptosis regulation in c-myc cell lines in normal and low serum was then investigated. Cells lines expressing c-myc and bcl-$\rm x\sb{L}$ were generated and were shown to be resistant to apoptosis induction in low serum. Furthermore, cell lines expressing c-myc, anti-sense bcl-$\rm x\sb{L}$ and $\beta$-galactosidase demonstrated significantly enhanced rates of apoptosis in high serum compared to c-myc Rat 1a cells. These findings suggest that c-myc activates a survival program involving bcl-$\rm x\sb{L}$ upregulation and bax downregulation. However, this survival signal is reduced under low serum conditions by the relative downregulation of bcl-$\rm x\sb{L}$ allowing for apoptosis to proceed. These data also directly demonstrates that downregulation in the level of bcl-$\rm x\sb{L}$ associated with low serum conditions is a critical determinant of c-myc induced apoptosis. ^

Examination of synthetic retinoid -induced apoptosis in cutaneous squamous cell carcinomas: Mechanisms and implications for chemoprevention and chemotherapy with retinoids

Non-melanoma skin cancers, including basal cell carcinoma and squamous cell carcinoma (SCC), are the most common neoplasms in the United States with a lifetime risk nearly equal to all other types of cancer combined. Retinoids are naturally occurring and synthetic analogues of vitamin A that bind to nuclear retinoid receptors and modulate gene expression as a means of regulating cell proliferation and differentiation. Retinoids have been employed for many years in the treatment of various cutaneous lesions and for cancer chemoprevention and therapy. The primary drawback limiting the use of retinoids is their toxicity, which is also associated with receptor-gene interactions. In this study, the effects of the synthetic retinoids N-(4-hydroxyphenyl)retinamide (4HPR) and 6-[3-(1-adamantyl)-4-hydroxyphenyl]-2-naphthalene carboxylic acid (CD437) were examined in cutaneous keratinocytes. Four human cutaneous SCC cell lines were examined along with normal human epidermal keratinocyte (NHEK) cells from two donors. Sensitivity to 4HPR or CD437 alone or in combination with other agents was determined via growth inhibition, cell cycle distributions, or apoptosis induction. Both synthetic retinoids were able to promote apoptosis in SCC cells more effectively than the natural retinoid all-trans retinoic acid. Apoptosis could not be inhibited by nuclear retinoic acid receptor antagonists. In NHEK cells, 4HPR induced apoptosis while CD437 promoted G1 arrest. 4HPR acted as a prooxidant by generating reactive oxygen species (ROS) in SCC and NHEK cells. 4HPR-induced apoptosis in SCC cells could be inhibited or potentiated by manipulating cellular defenses against oxidative stress, indicating an essential role for ROS in 4HPR-induced apoptosis. CD437 promoted apoptosis in SCC cells in S and G2/M phases of the cell cycle within two hours of treatment, and this rapid induction could not be blocked with cycloheximide. This study shows: (1) 4HPR- and CD437-induced apoptosis do not directly involve a traditional retinoid pathway; (2) 4HPR can act as a prooxidant as a means of promoting apoptosis; (3) CD437 induces apoptosis in SCC cells independent of protein synthesis and is potentially less toxic to NHEK cells; and (4) 4HPR and CD437 operate under different mechanisms with respect to apoptosis induction and this may potentially enhance their therapeutic index in vivo. ^

Effects of exogeneous p53 on growth suppression, apoptosis, and differentiation in oral cancer cell lines

The p53 gene is known to be one of the most commonly mutated genes in human cancers. Many squamous cell carcinomas of the head and neck (SCCHNs) have been shown to contain nonfunctional p53 as well. The use of p53-mediated gene therapy to treat such cancers has become an intensive area of research. Although there have been varied treatment responses to p53 gene therapy, the role that endogenous p53 status plays in this response has not been thoroughly examined. Because of this, the hypothesis of this study examined the role that the endogenous p53 status of cells plays in their response to p53 gene therapy. To test this, an adenoviral vector containing p53 (p53FAd) was administered to three squamous cell carcinoma lines with varied endogenous p53. The SCC9 cell line demonstrates no p53 protein expression, the SCC4 cell line displays overexpression of a mutant p53 protein, and the 1986LN cell line displays low to no expression of wild-type p53 protein as a consequence of human papillomavirus infection. After treatment with p53FAd, the cells were examined for evidence of exogenous p53 expression, growth suppression, alterations in cellular proteins, G1 growth arrest, apoptosis, and differentiation state. Each cell line exhibited exogenous p53 protein. Growth suppression was seen most prominently in the SCC9 cells, to some extent in the 1986LN cells, and little was seen with the SCC4 cells. WAF1/p21 protein was induced in all three cell lines, while PCNA, bcl-2, and bax expression was not significantly affected in any of the lines. Apoptosis developed first in SCC9 cells, next in 1986LN cells, with little seen in the SCC4 cells. The SCC9 line was the only line to show significant GI growth arrest. No significant differences were observed in the overall expression of differentiation markers, aside from increased keratin 13 mRNA levels in all three lines indicating a possible tendency toward differentiation. This study indicates that the endogenous p53 status of squamous cell carcinomas appears to play a critical role in determining the response to p53 adenoviral gene therapy. ^

A novel DNA damage inducible inhibitor of p53

p53 is required for the maintenance of the genomic stability of cells. Mutations in the p53 tumor-suppressor gene occur in more than 50% of human cancers of diverse types. In addition, 70% of families with Li-Fraumeni syndrome have a germline mutation in p53, predisposing these individuals to multiple forms of cancer. In response to DNA damage, p53 becomes stabilized and activated. However the exact mechanism by which DNA damage signals the stabilization and activation of p53 still remains elusive. The biochemical activity of p53 that is required for tumor suppression, and presumably the cellular response to DNA damage, involves the ability of the protein to bind to specific DNA sequences and to function as a transcription factor. For the downstream targets, p53 transactivates many genes involved in growth arrest, apoptosis and DNA repair such as p21, Bax and GADD45, respectively. An open question in the field is how cells can determine the downstream effects of p53. ^ We hypothesize that, through its associated proteins, p53 can differentially transactivate its target genes, which determine its downstream effect. Additionally, p53 interacting proteins may be involved in signaling for the stabilization and activation of p53. Therefore, a key aspect to understanding p53 function is the identification and analysis of proteins that interact with it. We have employed the Sos recruitment system (SRS), a cytoplasmic yeast two-hybrid screen to identify p53 interacting proteins. The SRS is based on the ability of Sos to activate Ras when it becomes localized to the plasma membrane. The system takes advantage of an S. cerevisiae strain, cdc25-2 temperature sensitive mutant, harboring a mutation in Sos. In this strain, fusion proteins containing a truncated Sos will only localize to the membrane by protein-protein interaction, which allows growth at non-permissive temperature. This system allows the use of intact transcriptional activators such as p53. ^ To date, using a modified SRS library screen to identify p53 interacting proteins, I have identified p53 (known to interact with itself) and a novel p53-interacting protein (PIP). PIP is a specific p53 interacting protein in the SRS. The interaction of p53 and PIP was further confirmed by performing in vitro and in vivo binding assays. In the in vivo binding study, the interaction can only be detected in the presence of ionizing radiation suggesting that this interaction might be involved in DNA-damage induced p53-signalling pathway. After screening cDNA and genomic libraries, a full-length PIP-cDNA clone ( ∼ 3kb) was obtained which encodes a protein of 429 amino acids with calculated molecular weight of 46 kDa. The results of genebank search indicated that the PIP is an unidentified gene and contains a conserved ring-finger domain, which is present in a diverse family of regulatory proteins involved in different aspects of cellular function. Northern blot analysis revealed that the size of its messenge is approximately 3 kb preferentially expressed in brain, heart, liver and kidney. The PIP protein is mainly located in the cytoplasm as determined by the cellular localization of a green fluorescence fusion protein. Preliminary functional analysis revealed that PIP downregulated the transactivation activity of p53 on both p21 and mdm2 promoters. Thus, PIP may be a novel negative regulator of p53 subsequent to DNA damage. ^