976 resultados para Sequence-analysis
Resumo:
Insulin-like growth factor binding protein 2 (IGFBP2) is a protein known to be overexpressed in a majority of glioblastoma multiforme (GBM) tumors. While it is known the IGFBP2 is involved in promoting GBM tumor cell invasion, no mechanism exists for how the protein is involved in signal transduction pathways leading to enhanced cell invasion. ^ We follow up on preliminary microarray data on IGFBP2-overexpressing GBM cells and protein sequence analysis of IGFBP2 in generating the hypothesis that IGFBP2 interacts with integnn α5 in regulating cell mobility. Microarray data showing upregulation of integrin α5 by IGFBP2 is validated and evidence of protein-protein interaction between IGFBP2 and integrin α5 is found. The exact binding domain on IGFBP2 responsible for its interaction with integrin α5 is also determined, confirming our initial findings and reaffirming that the IGFBP2/integrin α5 interaction is specific. Disruption of this interaction resulted in attenuation of IGFBP2-enhanced cell mobility. Further, we found that cell mobility is only enhanced when IGFBP2 and integrin α5 are both overexpressed and able to interact with each other. ^ We also determined fibronectin to be a critical player in the activation of the IGFBP2/integrin α5 pathway. The activation of this pathway appears to be progressive and initiates once GBM cells have sufficiently established anchorage. ^
Resumo:
The basis for the recent transition of Enterococcus faecium from a primarily commensal organism to one of the leading causes of hospital-acquired infections in the United States is not yet understood. To address this, the first part of my project assessed isolates from early outbreaks in the USA and South America using sequence analysis, colony hybridizations, and minimal inhibitory concentrations (MICs) which showed clinical isolates possess virulence and antibiotic resistance determinants that are less abundant or lacking in community isolates. I also revealed that the level of ampicillin resistance increased over time in clinical strains. By sequencing the pbp5 gene, I demonstrated an ~5% difference in the pbp5 gene between strains with MICs <4ug/ml and those with MICs >4µg/ml, but no specific sequence changes correlated with increases in MICs within the latter group. A 3-10% nucleotide difference was also seen in three other genes analyzed, which suggested the existence of two distinct subpopulations of E. faecium. This led to the second part of my project analyzing concatenated core gene sequences, SNPs, the 16S rRNA, and phylogenetics of 21 E. faecium genomes confirming two distinct clades; a community-associated (CA) clade and hospital-associated (HA) clade. Molecular clock calculations indicate that these two clades likely diverged ~ 300,000 to > 1 million years ago, long before the modern antibiotic era. Genomic analysis also showed that, in addition to core genomic differences, HA E. faecium harbor specific accessory genetic elements that may confer selection advantages over CA E. faecium. The third part of my project discovered 6 E. faecium genes with the newly identified “WxL” domain. My analyses, using RT-PCR, western blots, patient sera, whole-cell ELISA, and immunogold electron microscopy, indicated that E. faecium WxL genes exist in operons, encode bacterial cell surface localized proteins, that WxL proteins are antigenic in humans, and are more exposed on the surface of clinical isolates versus community isolates (even though they are ubiquitous in both clades). ELISAs and BIAcore analyses also showed that proteins encoded by these operons bind several different host extracellular matrix proteins, as well as to each other, suggesting a novel cell-surface complex. In summary, my studies provide new insights into the evolution of E. faecium by showing that there are two distantly related clades; one being more successful in the hospital setting. My studies also identified operons encoding WxL proteins whose characteristics could also contribute to colonization and virulence within this species.
Resumo:
Phosphatidylserine decarboxylase of E. coli, a cytoplasmic membrane protein, catalyzes the formation of phosphatidylethanolamine, the principal phospholipid of the organism. The activity of the enzyme is dependent on a covalently bound pyruvate (Satre and Kennedy (1978) J. Biol. Chem. 253, 479-483). This study shows that the enzyme consists of two nonidentical subunits, $\alpha$ (Mr = 7,332) and $\beta$ (Mr = 28,579), with the pyruvate prosthetic group in amide linkage to the amino-terminus of the $\alpha$ subunit. Partial protein sequence and DNA sequence analysis reveal that the two subunits are derived from a proenzyme ($\pi$ subunit, Mr = 35,893) through a post-translational event. During the conversion of the proenzyme to the $\alpha$ and $\beta$ subunits, the peptide bond between Gly253-Ser254 is cleaved, and Ser254 is converted to the pyruvate prosthetic group at the amino-terminus of the $\alpha$ subunit (Li and Dowhan (1988) J. Biol. Chem. 263, 11516-11522).^ The proenzyme cannot be detected in cells carrying either single or multiple copies of the gene (psd), but can be observed in a T7 RNA polymerase/promoter and transcription-translation system. The cleavage of the wild-type proenzyme occurs rapidly with a half-time on the order of 2 min. Changing of the Ser254 to cysteine (S254C) or threonine (S254T) slows the cleavage rate dramatically and results in mutants with a half-time for processing of around 2-4 h. Change of the Ser254 to alanine (S254A) blocks the cleavage of the proenzyme. The reduced processing rate with the mutations of the proenzyme is consistent with less of the functional enzyme being made. Mutants S254C and S254T produce $\sim$15% and $\sim$1%, respectively, of the activity of the wild-type allele, but can still complement a temperature-sensitive mutant of the psd locus. Neither detectable activity nor complementation is observed by mutant S254A. These results are consistent with the hydroxyl-group of the Ser254 playing a critical role in the cleavage of the peptide bond Gly253-Ser254 of the pro-phosphatidylserine decarboxylase, and support the mechanism proposed by Snell and co-workers (Recsei and Snell (1984) Annu. Rev. Biochem. 53, 357-387) for the formation of the prosthetic group of pyruvate-dependent decarboxylases. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
The neuropeptide somatostatin is a widely distributed general inhibitor of endocrine, exocrine, gastrointestinal and neural functions. The biological actions of somatostatin are initiated by interaction with high affinity, plasma membrane somatostatin receptors (sst receptors). Five sst receptor subtypes have been cloned and sequence analysis shows they are all members of the G protein coupled receptor superfamily. The G proteins play a pivotal role in sst receptor signal transduction and the specificity of somatostatin receptor-G protein coupling defines the possible range of cellular responses. However, the data for endogenous sst receptor and G protein coupling is very limited, and even when it is available, the sst receptor subtypes involved in G protein coupling and signal transduction are unknown due to the expression of multiple sst receptor subtypes in target cell lines or tissues of somatostatin.^ In an effort to characterize each individual sst receptor subtypes, antisera against unique C-terminal regions of different sst receptor subtypes have been developed in our lab. In this report, antisera made against the sst1, sst2A and sst4 receptors are characterized. They are highly specific to their corresponding receptors and efficiently immunoprecipitate the sst receptors. Using these antibodies, the cell lines expressing these sst receptor subtypes were identified with both immunoprecipitation and Western blot methods. The development of sst receptor subtype specific antibodies make it possible to determine the specificity of the sst receptor subtype and G protein coupling in target cells or tissues expressing multiple sst receptors, two questions were addressed by this thesis: (1) whether different cellular environments affect receptor subtype and G protein coupling; (2) whether different sst receptors couple to different G proteins in similar cellular environments.^ Taken together our findings, both sst1 and sst2A receptors couple with G$\alpha\sb{\rm i1},$ G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in CHO cells, G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in GH$\sb4$C$\sb1$ cells. Further, sst2A receptors couple with G$\alpha\sb{\rm i1},$ G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in AR4-2J cells while sst4 receptors couple with G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in CHO cells. Therefore, the G protein coupling of the same sst receptors in different cell lines is basically similar in that they all couple with multiple $\alpha$-subunits of the G$\rm \sb{i}$ proteins, suggesting cellular environment has little effect on receptor and G protein coupling. Moreover, different sst receptors have similar G protein coupling specificities in the same cell line, suggesting components other than receptor and G$\alpha$ subunits in the signal transduction pathways may contribute to specific functions of each sst receptor subtype. This series of experiments represent a novel approach in dissecting signal transduction pathways and may have general application in the field. Furthermore, this is the first systematic study of sst receptor subtype and G protein $\alpha$-subunit interaction in both transfected cells and in normal cell lines. The information generated will be very useful in our understanding of sst receptor signal transduction pathways and in directing future sst receptor research. ^
Resumo:
The purpose of this study was to investigate the role of the c-KIT receptor in the progression of human melanoma and the mechanism(s) for the regulation of c-KIT gene expression in human melanoma.^ The molecular changes associated with the transition of melanoma cells from radial growth phase (RGP) to vertical growth phase (VGP) (metastatic phenotype) are not well-defined. Expression of the tyrosine-kinase receptor c-KIT progressively decreases during local tumor growth and invasion of human melanomas. To provide direct evidence that the metastasis of human melanoma is associated with the loss of c-KIT expression, highly metastatic A375SM cells, which express very low or undetectable levels of c-KIT, were tranduced with the human c-KIT gene. We demonstrated that enforced c-KIT expression in highly metastatic human melanoma cells significantly suppressed their tumorigenicity and metastatic propensity in nude mice. In addition, we showed that the ligand for c-KIT, SCF, induces apoptosis in human melanoma cells expressing c-KIT under both in vitro and in vivo conditions. These results suggest that loss of c-KIT receptor may allow malignant melanoma cells to escape SCF/c-KIT-mediated apoptosis, thus contributing to tumor growth and eventually metastasis.^ Furthermore, we investigated the possible mechanism(s) for the down-regulation of c-KIT gene expression in malignant melanoma. Sequence analysis of the c-KIT promoter indicated that this promoter contains several consensus binding-site sequences including three putative AP2 and two Myb sites. Although Myb was shown to be associated with c-KIT expression in human hemotopoietic cells, we found no correlation between c-KIT expression and Myb expression in human melanoma cell lines. In contrast, we showed that c-KIT expression directly correlates with expression of AP2 in human melanoma cells. We found that highly metastatic cells do not express the transcription factor AP2. Expression of AP2 in A375SM cells (c-KIT-negative and AP2-negative) was enough to restore luciferase activity driven by the c-KIT promoter in a dose-dependent manner. On the other hand, co-expression of the dominant-negative form of AP2 (AP2B) in Mel-501 cells (c-KIT-positive and AP2-positive) resulted in two-fold reduction in luciferase activity. Electrophoretic mobility shift assays revealed that the c-KIT promoter contains functional AP2 binding sites which could associate with AP2 protein. Endogenous c-KIT gene expression levels were elevated in AP2 stably-transfected human melanoma A375SM cells. Expression of exogenous AP2 in A375SM cells inhibited their tumorigenicity and metastatic potential in nude mice. The c-KIT ligand, SCF, also induced apoptosis in the AP2 stably-transfected A375SM cells. The identification of AP2 as an important regulator for c-KIT expression suggests that AP2 may have tumor growth and metastasis inhibitory properties, possibly mediated through c-KIT/SCF effects on apoptosis of human melanoma cells. Since AP2 binding sites were found in the promoters of other genes involved in the progression of human melanoma, such as MMP2 (72 kDa collagenase), MCAM/MUC18 and P21/WAF-1, our findings suggest that loss of AP2 expression might be a crucial event in the development of malignant melanoma. ^
Resumo:
The Bacillus anthracis toxin genes, cya, lef , and pag, can be viewed as a regulon, in which transcription of all three genes is activated in trans by the same regulatory gene, atxA, in response to the same signal, CO2. I determined that several phenotypes are associated with the atxA gene. In addition to being toxin-deficient, an atxA -null mutant grows poorly on minimal media and sporulates early compared to the parent strain. Furthermore, an atxA-null mutant has an altered 2-D gel protein profile. I used a genetic approach to find additional atxA-regulated genes. Random transcriptional lacZ fusions were generated in B. anthracis using transposon Tn 917-LTV3. Transposon-insertion libraries were screened for mutants expressing increased β-galactosidase activity in 5% CO2. Introduction of an atxA-null mutation in these mutants revealed that 79% of the CO2-regulated fusions were also atxA-dependent. DNA sequence analysis of transposon insertion sites in mutants carrying CO 2/atxA-regulated fusions revealed ten mutants harboring transposon insertions in loci distinct from the toxin genes. The majority of the tcr (toxin co-regulated) loci mapped within the pXO1 pathogenicity island. These results indicate a clear association of atxA with CO2-enhanced gene expression in B. anthracis and provide evidence that atxA regulates genes other than the structural genes for the anthrax toxin proteins. ^ Characterization of one tcr locus revealed a new regulatory gene, pagR. The pagR gene (300 nt) is located downstream of pag. pagR is cotranscribed with pag and is responsible for autogenous control of the operon. pagR also represses expression of cya and lef. Repression of toxin gene expression by pagR may be mediated by atxA. The steady state level of atxA mRNA is increased in a pagR mutant. Recombinant PagR protein purified from Escherichia coli did not specifically bind the promoter regions of pagA or atxA. An unidentified factor in B. anthracis crude extracts, however, was able to bind the atxA promoter in the absence of PagR or AtxA. These investigations increase our knowledge of virulence regulation in B. anthracis and ultimately will lead to a better understanding of anthrax disease. ^
Resumo:
Dictyostelium, a soil amoeba, is able to develop from free-living cells to multicellular fruiting bodies upon starvation using extracellular cAMP to mediate cell-cell communication, chemotaxis and developmental gene expression. The seven transmembrane G protein-coupled cAMP receptor-1 (cAR1) mediated responses, such as the activation of adenylyl cyclase and guanylyl cyclase, are transient, due to the existence of poorly understood adaptation mechanisms. For this dissertation, the powerful genetics of the Dictyostelium system was employed to study the adaptation mechanism of cAR1-mediated cAMP signaling as well as mechanisms intrinsic to cAR1 that regulate its activation. ^ We proposed that constitutively active cAR1 would cause constant adaptation, thus inhibiting downstream pathways that are essential for aggregation and development. Therefore, a screen for dominant negative cAR1 mutants was undertaken to identify constitutively active receptor mutants. Three dominant negative cAR1 mutants were identified. All appear to be constitutively active receptor mutants because they are constitutively phosphorylated and possess high affinity for cAMP. Biochemical studies showed that these mutant receptors prevented the activation of downstream effectors, including adenylyl and guanylyl cyclases. In addition, these cells also were defective in cAMP chemotaxis and cAR1-mediated gene expression. These findings suggest that the mutant receptors block development by constantly activating multiple adaptation pathways. ^ Sequence analysis revealed that these mutations (I104N, L100H) are clustered in a conserved region of the third transmembrane helix (TM3) of cAR1. To investigate the role of this region in receptor activation, one of these residues, I104, was mutated to all the other 19 possible amino acids. We found that all but the most conservative substitutions increase the receptor's affinity about 20- to 70-fold. However, only highly polar substitutions of I104, particularly basic residues, resulted in receptors that are constitutively phosphorylated and dominantly inhibit development, suggesting that highly polar substitutions not only disrupt an interaction constraining the receptor in its low-affinity, inactive state but also promote an additional conformational change that resembles the ligand-bound conformation. Our findings suggest that I104 plays a specific role in constraining the receptor in its inactive state and that substituting it with highly polar residues results in constitutive activation. ^
Resumo:
Light absorption is an important process for energy production and sensory perception in many organisms. In the filamentous fungus, Neurospora crassa, blue-light is an important regulator of both asexual and sexual development, but the identity of the blue-light receptor is unknown. The work presented in this dissertation initiated the characterization of the putative N. crassa opsin photoreceptor, NOP-1. Opsins were thought to exist only in the archaea and mammals until the discovery of nop-1. All opsins have the same conserved structure of seven transmembrane helical domains with a lysine residue in the seventh helix specific for forming a Schiff-base linkage with retinal. The predicted NOP-1 protein sequence is equally similar to archaeal rhodopsins and a newly identified fungal opsin-related protein group (ORPs). ORPs maintain the seven transmembrane helical structure of opsins, but lack the conserved lysine residue for binding retinal. An ORP gene, orp-1 was identified in N. crassa and this work includes the cloning and sequence analysis of this gene. Characterization of NOP-1 function in N. crassa development began with the construction of a Δnop-1 deletion mutant. Extensive phenotypic analysis of Δnop-1 mutants revealed only subtle defects during development primarily under environmental conditions that induce a stress response. NOP-1 was overexpressed in the heterologous system Pichia pastoris, and it was demonstrated that NOP-1 protein bound all-trans retinal to form a green-light absorbing pigment (λmax = 534 nm) with a photochemical reaction cycle similar to archaeal sensory rhodopsins. nop-1 gene expression was monitored during N. crassa development. nop-1 transcript is highly expressed during asexual sporulation (conidiation) and transcript levels are abundant in the later stages of conidial development. nop-1 expression is not regulated by blue-light or elevated temperatures. Potential functions for NOP-1 were discovered through the transcriptional analysis of conidiation-associated genes in Δnop-1 mutants. NOP-1 exhibits antagonistic transcriptional regulation of conidiation-associated genes late in conidial development, by enhancing the carotenogenic gene, al-2 and repressing the conidiation-specific genes, con-10 and con-13. ^
Resumo:
Distinctive, massive to stratified, pale blue volcaniclastics, initially referred to as the "blue tuff," were encountered at all four sites drilled during ODP Leg 127 in the Japan Sea. Detailed vertical sequence analysis, plagioclase chemistry, plagioclase 87Sr/86Sr isotopic composition, and 40Ar/39Ar age dating indicate that thick sequences of the blue tuff are not genetically related. Blue tuffs at Hole 794B were apparently deposited by density flows at ambient temperature. Deposition was penecontemporaneous with a large submarine phreatomagmatic eruption at 14.9 Ma in bathyal or deeper water depths. The blue tuffs at this location comprise mostly reworked hydroclastic glass shards and lesser amounts of plagioclase crystals. Pyrogenic plagioclase has an average An mole% of 18±3. Comparison of blue tuff plagioclase compositions with the composition of plagioclase from acoustic basement at Site 794 suggests that these rocks are not genetically related. As such, the extrapolation of sediment accumulation rate data in conjunction with this more precise age for the blue tuff corroborates previous minimum age estimates of 16.2 Ma for acoustic basement at Site 794. Blue tuffs at Hole 796B were probably deposited at ambient temperatures by downslope slumping and density flow of reworked pyrogenic debris. This debris includes abundant bubble wall glass shards and plagioclase crystals, with variable admixture of volcanic lithic and intrabasinal fragments. Pyrogenic fragments were produced by subaerial or shallow submarine, magmatic eruptions dated at 7.6 Ma. Blue tuffs contain a heterogeneous mixture of unrelated fragments including a mixed population of plagioclase crystals. The average An mole% of the predominant, probable comagmatic, plagioclase population is 30±4. The two sequences of blue tuff studied are distinct in age, mineral composition, and the eruptive origin of pyroclastic fragments. Preliminary 87Sr/86Sr isotopic compositions of plagioclase, however, indicates that blue tuffs at both locations are the product of typical, subduction-related island arc magmatism. Based on the results of this study, there is no justification for stratigraphic correlation of widespread, Miocene, blue to blue-gray bentonitic tuff and tuffaceous sandstones nor the interpretation that these strata are indicative of regional, explosive submarine volcanism genetically related to rifting and formation of the Japan Sea. Rather, these reworked pyroclastic strata of intermediate composition were deposited over a protracted 6-8 m.y. period in association with widespread, subduction-related submarine to subaerial volcanism in the Japan Sea backarc basin.
Resumo:
The ultramafic-hosted Logatchev hydrothermal field (LHF) is characterized by vent fluids, which are enriched in dissolved hydrogen and methane compared with fluids from basalt-hosted systems. Thick sediment layers in LHF are partly covered by characteristic white mats. In this study, these sediments were investigated in order to determine biogeochemical processes and key organisms relevant for primary production. Temperature profiling at two mat-covered sites showed a conductive heating of the sediments. Elemental sulfur was detected in the overlying mat and metal-sulfides in the upper sediment layer. Microprofiles revealed an intensive hydrogen sulfide flux from deeper sediment layers. Fluorescence in situ hybridization showed that filamentous and vibrioid, Arcobacter-related Epsilonproteobacteria dominated the overlying mats. This is in contrast to sulfidic sediments in basalt-hosted fields where mats of similar appearance are composed of large sulfur-oxidizing Gammaproteobacteria. Epsilonproteobacteria (7- 21%) and Deltaproteobacteria (20-21%) were highly abundant in the surface sediment layer. The physiology of the closest cultivated relatives, revealed by comparative 16S rRNA sequence analysis, was characterized by the capability to metabolize sulfur com- ponents. High sulfate reduction rates as well as sulfide depleted in 34S further confirmed the importance of the biogeochemical sulfur cycle. In contrast, methane was found to be of minor relevance for microbial life in mat-covered surface sediments. Our data indicate that in conductively heated surface sediments microbial sulfur cycling is the driving force for bacterial biomass production although ultramafic- hosted systems are characterized by fluids with high levels of dissolved methane and hydrogen.
Resumo:
The microbial population in samples of basalt drilled from the north of the Australian Antarctic Discordance (AAD) during Ocean Drilling Program Leg 187 were studied using deoxyribonucleic acid (DNA)-based methods and culturing techniques. The results showed the presence of a microbial population characteristic for the basalt environment. DNA sequence analysis revealed that microbes grouping within the Actinobacteria, green nonsulfur bacteria, the Cytophaga/Flavobacterium/Bacteroides (CFB) group, the Bacillus/Clostridium group, and the beta and gamma subclasses of the Proteobacteria were present in the basalt samples collected. The most dominant phylogenetic group, both in terms of the number of sequences retrieved and the intensities of the DNA bands obtained with the denaturing gradient gel electrophoresis analysis, was the gamma Proteobacteria. Enrichment cultures showed phylogenetic affiliation with the Actinobacteria, the CFB group, the Bacillus/Clostridium group, and the alpha, beta, gamma, and epsilon subclasses of the Proteobacteria. Comparison of native and enriched samples showed that few of the microbes found in native basalt samples grew in the enrichment cultures. Only seven clusters, two clusters within each of the CFB and Bacillus/Clostridium groups and five clusters within the gamma Proteobacteria, contained sequences from both native and enriched basalt samples with significant similarity. Results from cultivation experiments showed the presence of the physiological groups of iron reducers and methane producers. The presence of the iron/manganese-reducing bacterium Shewanella was confirmed with DNA analysis. The results indicate that iron reducers and lithotrophic methanogenic Archaea are indigenous to the ocean crust basalt and that the methanogenic Archaea may be important primary producers in this basaltic environment.
Resumo:
El trigo blando (Triticum aestivum ssp vulgare L., AABBDD, 2n=6x=42) presenta propiedades viscoélasticas únicas debidas a la presencia en la harina de las prolaminas: gluteninas y gliadinas. Ambos tipos de proteínas forman parte de la red de gluten. Basándose en la movilidad en SDS-PAGE, las gluteninas se clasifican en dos grupos: gluteninas de alto peso molecular (HMW-GS) y gluteninas de bajo peso molecular (LMW-GS). Los genes que codifican para las HMW-GS se encuentran en tres loci del grupo 1 de cromosomas: Glu-A1, Glu-B1 y Glu-D1. Cada locus codifica para uno o dos polipéptidos o subunidades. La variación alélica de las HMW-GS es el principal determinante de de la calidad harino-panadera y ha sido ampliamente estudiado tanto a nivel de proteína como de ADN. El conocimiento de estas proteínas ha contribuido sustancialmente al progreso de los programas de mejora para la calidad del trigo. Comparadas con las HMW-GS, las LMW-GS forman una familia proteica mucho más compleja. La mayoría de los genes LMW se localizan en el grupo 1 de cromosomas en tres loci: Glu-A3, Glu-B3 y Glu-D3 que se encuentran estrechamente ligados a los loci que codifican para gliadinas. El número de copias de estos genes ha sido estimado entre 10-40 en trigo hexaploide, pero el número exacto aún se desconoce debido a la ausencia de un método eficiente para diferenciar los miembros de esta familia multigénica. La nomenclatura de los alelos LMW-GS por electroforesis convencional es complicada, y diferentes autores asignan distintos alelos a la misma variedad lo que dificulta aún más el estudio de esta compleja familia. El uso de marcadores moleculares para la discriminación de genes LMW, aunque es una tarea dificil, puede ser muy útil para los programas de mejora. El objetivo de este trabajo ha sido profundizar en la relación entre las gluteninas y la calidad panadera y desarrollar marcadores moleculares que permitan ayudar en la correcta clasificación de HMW-GS y LMW-GS. Se han obtenido dos poblaciones de líneas avanzadas F4:6 a partir de los cruzamientos entre las variedades ‘Tigre’ x ‘Gazul’ y ‘Fiel’ x ‘Taber’, seleccionándose para los análisis de calidad las líneas homogéneas para HMW-GS, LMW-GS y gliadinas. La determinación alélica de HMW-GS se llevó a cabo por SDS-PAGE, y se complementó con análisis moleculares, desarrollándose un nuevo marcador de PCR para diferenciar entre las subunidades Bx7 y Bx7*del locus Glu-B1. Resumen 2 La determinación alélica para LMW-GS se llevó a cabo mediante SDS-PAGE siguiendo distintas nomenclaturas y utilizando variedades testigo para cada alelo. El resultado no fue concluyente para el locus Glu-B3, así que se recurrió a marcadores moleculares. El ADN de los parentales y de los testigos se amplificó usando cebadores diseñados en regiones conservadas de los genes LMW y fue posteriormente analizado mediante electroforesis capilar. Los patrones de amplificación obtenidos fueron comparados entre las distintas muestras y permitieron establecer una relación con los alelos de LMW-GS. Con este método se pudo aclarar la determinación alélica de este locus para los cuatro parentales La calidad de la harina fue testada mediante porcentaje de contenido en proteína, prueba de sedimentación (SDSS) y alveógrafo de Chopin (parámetros P, L, P/L y W). Los valores fueron analizados en relación a la composición en gluteninas. Las líneas del cruzamiento ‘Fiel’ x ‘Taber’ mostraron una clara influencia del locus Glu-A3 en la variación de los valores de SDSS. Las líneas que llevaban el nuevo alelo Glu-A3b’ presentaron valores significativamente mayores que los de las líneas con el alelo Glu-A3f. En las líneas procedentes del cruzamiento ‘Tigre ’x ‘Gazul’, los loci Glu-B1 y Glu-B3 loci mostraron ambos influencia en los parámetros de calidad. Los resultados indicaron que: para los valores de SDSS y P, las líneas con las HMW-GS Bx7OE+By8 fueron significativamente mejores que las líneas con Bx17+By18; y las líneas que llevaban el alelo Glu-B3ac presentaban valores de P significativamente superiores que las líneas con el alelo Glu-B3ad y significativamente menores para los valores de L . El análisis de los valores de calidad en relación a los fragmentos LMW amplificados, reveló un efecto significativo entre dos fragmentos (2-616 y 2-636) con los valores de P. La presencia del fragmento 2-636 estaba asociada a valores de P mayores. Estos fragmentos fueron clonados y secuenciados, confirmándose que correspondían a genes del locus Glu-B3. El estudio de la secuencia reveló que la diferencia entre ambos se hallaba en algunos SNPs y en una deleción de 21 nucleótidos que en la proteína correspondería a un InDel de un heptapéptido en la región repetida de la proteína. En este trabajo, la utilización de líneas que difieren en el locus Glu-B3 ha permitido el análisis de la influencia de este locus (el peor caracterizado hasta la fecha) en la calidad panadera. Además, se ha validado el uso de marcadores moleculares en la determinación alélica de las LMW-GS y su relación con la calidad panadera. Summary 3 Bread wheat (Triticum aestivum ssp vulgare L., AABBDD, 2n=6x=42) flour has unique dough viscoelastic properties conferred by prolamins: glutenins and gliadins. Both types of proteins are cross-linked to form gluten polymers. On the basis of their mobility in SDS-PAGE, glutenins can be classified in two groups: high molecular weight glutenins (HMW-GS) and low molecular weight glutenins (LMW-GS). Genes encoding HMW-GS are located on group 1 chromosomes in three loci: Glu-A1, Glu-B1 and Glu-D1, each one encoding two polypeptides, named subunits. Allelic variation of HMW-GS is the most important determinant for bread making quality, and has been exhaustively studied at protein and DNA level. The knowledge of these proteins has substantially contributed to genetic improvement of bread quality in breeding programs. Compared to HMW-GS, LMW-GS are a much more complex family. Most genes encoded LMW-GS are located on group 1 chromosomes. Glu-A3, Glu-B3 and Glu-D3 loci are closely linked to the gliadin loci. The total gene copy number has been estimated to vary from 10–40 in hexaploid wheat. However, the exact copy number of LMW-GS genes is still unknown, mostly due to lack of efficient methods to distinguish members of this multigene family. Nomenclature of LMW-GS alleles is also unclear, and different authors can assign different alleles to the same variety increasing confusion in the study of this complex family. The use of molecular markers for the discrimination of LMW-GS genes might be very useful in breeding programs, but their wide application is not easy. The objective of this work is to gain insight into the relationship between glutenins and bread quality, and the developing of molecular markers that help in the allele classification of HMW-GS and LMW-GS. Two populations of advanced lines F4:6 were obtained from the cross ‘Tigre’ x ‘Gazul’ and ‘Fiel’ x ‘Taber’. Lines homogeneous for HMW-GS, LMW-GS and gliadins pattern were selected for quality analysis. The allele classification of HMW-GS was performed by SDS-PAGE, and then complemented by PCR analysis. A new PCR marker was developed to undoubtedly differentiate between two similar subunits from Glu-B1 locus, Bx7 and Bx7*. The allele classification of LMW-GS was initially performed by SDS-PAGE following different established nomenclatures and using standard varieties. The results were not completely concluding for Glu-B3 locus, so a molecular marker system was applied. DNA from parental lines and standard varieties was amplified using primers designed in conserved domains of LMW genes and analyzed by capillary electrophoresis. The pattern of amplification products obtained was compared among samples and related to the protein allele classification. It was possible to establish a correspondence between specific amplification products and almost all LMW alleles analyzed. With this method, the allele classification of the four parental lines was clarified. Flour quality of F4:6 advanced lines were tested by protein content, sedimentation test (SDSS) and alveograph (P, L, P/L and W). The values were analyzed in relation to the lines prolamin composition. In the ‘Fiel’ x ‘Taber’ population, Glu-A3 locus showed an influence in SDSS values. Lines carrying new allele Glu-A3b’, presented a significantly higher SDSS value than lines with Glu-A3f allele. In the ‘Tigre ’x ‘Gazul’ population, the Glu-B1 and Glu-B3 loci also showed an effect in quality parameters, in SDSS, and P and L values. Results indicated that: for SDSS and P, lines with Bx7OE+By8 were significantly better than lines with Bx17+By18; lines carrying Glu-B3ac allele had a significantly higher P values than Glu-B3ad allele values. lines with and lower L The analysis of quality parameters and amplified LMW fragments revealed a significant influence of two peaks (2-616 y 2-636) in P values. The presence of 2-636 peak gave higher P values than 2-616. These fragments had been cloned and sequenced and identified as Glu-B3 genes. The sequence analysis revealed that the molecular difference between them was some SNPs and a small deletion of 21 nucleotides that in the protein would produce an InDel of a heptapeptide in the repetitive region. In this work, the analysis of two crosses with differences in Glu-3 composition has made possible to study the influence of LMG-GS in quality parameters. Specifically, the influence of Glu-B3, the most interesting and less studied loci has been possible. The results have shown that Glu-B3 allele composition influences the alveograph parameter P (tenacity). The existence of different molecular variants of Glu-B3 alleles have been assessed by using a molecular marker method. This work supports the use of molecular approaches in the study of the very complex LMW-GS family, and validates their application in the analysis of advanced recombinant lines for quality studies.