Peptide nucleic acids: Mechanism of tight binding and application in artificial nuclease

Peptide nucleic acids (PNA) are mimics of nucleic acids with a peptidic backbone. Duplexes and triplexes formed between PNA and DNA or RNA possess remarkable thermal stability, they are resistant to nuclease cleavage and can better discriminate mismatches. Understanding the mechanism for the tight binding between PNA and oligonucleotides is important for the design and development of better PNA-based drugs.^ We have performed molecular dynamics (MD) simulations of 8-mer PNA/DNA duplex and two analogous duplexes with chiral modification of PNA strand (D- or L-Alanine modification). MD simulations were performed with explicit water and Na$\sp{+}$ counter ions. The 1.5-ns simulations were carried out with AMBER using periodic boundary and particle mesh Ewald summation. The point charges for PNA monomers were derived from fitting electrostatic potentials, obtained from ab initio calculation, to atomic centers using RESP. Derived charges reveal significantly altered charge distribution on the PNA bases and predict the Watson-Crick H-bonds involving PNA to be stronger. Results from NMR studies investigating H-bond interactions between DNA-DNA and DNA-PNA base pairs in non-polar environment are consistent with this prediction. MD simulations demonstrated that the PNA strand is more flexible than the DNA strand in the same duplex. That this flexibility might be important for the duplex stability is tested by introducing modification into the PNA backbones. Results from MD simulation revealed dramatically altered structures for the modified PNA-DNA duplexes. Consistent with previous NMR results, we also found no intrachain hydrogen bonds between O7$\sp\prime$ and N1$\sp\prime$ of the neighboring residues in our MD study. Our study reveals that in addition to the lack of charge repulsion, stronger Watson-Crick hydrogen bonds together with flexible backbone are important factors for the enhanced stability of the PNA-DNA duplex.^ In a related study, we have developed an application of Gly-Gly-His-(Gly)$\sb3$-PNA conjugate as an artificial nuclease. We were able to demonstrate cleavage of single stranded DNA at a single site upon Ni(II) binding to Gly-Gly-His tripeptide and activation of nuclease with monoperoxyphthalic acid. ^

THE MECHANISM OF RETINOIC ACID REGULATION OF TISSUE TRANSGLUTAMINASE GENE EXPRESSION

Retinoic acid regulates cellular growth and differentiation by altering the expression of specific sets of genes, but the molecular mechanism by which this is achieved is unknown. We have used the rapid induction of a specific enzyme, tissue transglutaminase in mouse macrophages, human leukemia cells and a variety of other cell types to study the regulation of gene expression by retinoic acid. Soluble retinoic acid binding proteins, such as cellular Retinoic Acid Binding Protein (cRABP), have been proposed as specific mediators of retinoic acid regulation of gene expression. This thesis demonstrates the lack of cRABP in a number of cell lines which are sensitive to retinoic acid regulation of tissue transglutaminase expression. These cells are also devoid of other soluble retinoic acid binding activity. The level of retinoic acid binding activity that could have been detected (6 fmol) is far below that of most cells and tissues which are sensitive to the effects of retinoic acid on growth and differentiation. A mouse melanoma cell line, S91-C2, was found to contain an unusual retinoic acid binding protein which has a lower affinity for retinoic acid than mouse tissue cRABP and also behaves differently on gel filtration HPLC chromatography.^ The induction of tissue transglutaminase by retinoic acid in macrophages is specifically inhibited by pertussis toxin. Pertussis toxin ADP-riblosylates membrane GTP-binding proteins such as N(,i) and interferes with signalling from plasma membrane receptors to regulatory enzymes. Pertussis toxin inhibition of transglutaminase induction is due to inhibition of tissue transglutaminase mRNA accumulation and is paralleled by the ADP-ribosylation of a 41,000 dalton macrophage membrane protein. It is concluded that soluble retinoic acid binding proteins are not essential for retinoic acid induction of tissue transglutaminase and that a membrane GTP-binding protein is closely linked to the sensitive response of macrophages to retinoic acid. ^

REGULATION OF THE EXPRESSION OF NAR OPERON ENCODING NITRATE REDUCTASE IN ESCHERICHIA COLI

The nar operon, which encodes the nitrate reductase in Escherichia coli, can be induced under anaerobic conditions without nitrate to a low level and with nitrate to a maximum level. The anaerobic formation of nitrate reductase is dependent upon the fnr gene product while the narL gene product is required for further induction by nitrate. The sequence was determined across the entire promoter and regulatory region of the nar operon. The translational start site of the first structural gene of the nar operon, narG gene, was established by identifying the nucleotide sequence for the first 20 N-terminal amino acid residues of the alpha subunit of nitrate reductase. The transcriptional start site and the level of the transcript was determined by S1 mapping procedure. One major transcript was identified which was initiated 50 base pair (bp) upstream from the translational start site of the first structural gene. The synthesis of the transcript was repressed aerobically, fully induced by nitrate anaerobically, and greatly reduced in a ${\rm Fnr\sp-}$ mutant. Deletions were created in the 5$\sp\prime$ nar regulatory sequence with either an intact nar operon or a nar::lacZ fusion. The expression of the plasmids with deletions were determined in a strain with wild type fnr and narL loci, a Fnr- mutant strain and a NarL- mutant strain. These experiments demonstrated that the $5\sp\prime$ limit of the nar operon lies at about $-210$ bp from the transcription start site. The region required for anaerobic induction by the fnr gene product is located around $-60$ bp. Two putative narL recognition sites were identified, one of which is around $-200$ and another immediately adjacent to the fnr recognition region. The deletion of the sequences around $-200$ rendered the remaining narL complex repressive and thus decreased the expression of nar operon, suggesting that the two potential narL sites interact with each other over a significant length of DNA. ^

Stomatal opening at elevated temperature: an underestimated regulatory mechanism?

Climate models predict more frequent and more severe extreme events (e.g. heat waves, extended drought periods) in Europe during the next decades. The response of plants to elevated temperature is a key issue in this context. Stomatal regulation is not only relevant for the diffusion of CO2 from the ambient air into the leaves, but it plays also an important role for the control of transpiration and leaf cooling. The regulation of stomatal aperture by the water status (hydroactive and hydropassive feed-back) and by internal CO2 availability (CO2 feed-back) are well documented in the literature, while the response of the stomates to elevated temperature was far less considered in the past. Photosynthesis is negatively affected by elevated temperature, but the water loss via transpiration may still be high. In the experiments reported here, bean leaf segments were incubated in darkness floating on water in the range from 20 to 50°C and then analyzed immediately by taking a photograph with a digital microscope. Stomatal aperture was measured on these pictures in order to quantify stomatal opening. After the incubation for 30 min, the opening was 0.66, 2.76 and 4.28 μm at 23, 30 and 35°C respectively. This opening at elevated temperature was fully reversible. Abscisic acid (0.1 μM) in the incubation medium shifted the temperature for stomatal opening to higher values. It can be concluded that elevated temperature stimulates stomatal opening regardless of the CO2 assimilation status and that there is a trade-off between leaf cooling on one hand and limiting water loss during drought periods on the other hand.

Elucidation of Nucleic Acid–Drug Interactions by Tandem Mass Spectrometry

In continuation of the long tradition of mass spectrometric research at the University of Bern, our group focuses on the characterization of nucleic acids as therapeutic agents and as drug targets. This article provides a short overview of our recent work on platinated single-stranded and higher-order nucleic acids. Nearly three decades ago the development of soft ionization techniques opened a whole new chapter in the mass spectrometric analysis of not only nucleic acids themselves, but also their interactions with potential drug candidates. In contrast to modern next generation sequencing approaches, though, the goal of the tandem mass spectrometric investigation of nucleic acids is by no means the complete sequencing of genetic DNA, but rather the characterization of short therapeutic and regulatory oligonucleotides and the elucidation of nucleic acid–drug interactions. The influence of cisplatin binding on the gas-phase dissociation of nucleic acids was studied by the means of electrospray ionization tandem mass spectrometry. Experiments on native and modified DNA and RNA oligomers confirmed guanine base pairs as the preferred platination site and laid the basis for the formulation of a gas-phase fragmentation mechanism of platinated oligonucleotides. The study was extended to double stranded DNA and DNA quadruplexes. While duplexes are believed to be the main target of cisplatin in vivo, the recently discovered DNA quadruplexes constitute another promising target for anti-tumor drugs owing to their regulatory functions in the cell cycle.

Identification of amino acid substitutions with compensational effects in the attachment protein of canine distemper virus.

The hemagglutinin (H) gene of canine distemper virus (CDV) encodes the receptor-binding protein. This protein, together with the fusion (F) protein, is pivotal for infectivity since it contributes to the fusion of the viral envelope with the host cell membrane. Of the two receptors currently known for CDV (nectin-4 and the signaling lymphocyte activation molecule [SLAM]), SLAM is considered the most relevant for host susceptibility. To investigate how evolution might have impacted the host-CDV interaction, we examined the functional properties of a series of missense single nucleotide polymorphisms (SNPs) naturally accumulating within the H-gene sequences during the transition between two distinct but related strains. The two strains, a wild-type strain and a consensus strain, were part of a single continental outbreak in European wildlife and occurred in distinct geographical areas 2 years apart. The deduced amino acid sequence of the two H genes differed at 5 residues. A panel of mutants carrying all the combinations of the SNPs was obtained by site-directed mutagenesis. The selected mutant, wild type, and consensus H proteins were functionally evaluated according to their surface expression, SLAM binding, fusion protein interaction, and cell fusion efficiencies. The results highlight that the most detrimental functional effects are associated with specific sets of SNPs. Strikingly, an efficient compensational system driven by additional SNPs appears to come into play, virtually neutralizing the negative functional effects. This system seems to contribute to the maintenance of the tightly regulated function of the H-gene-encoded attachment protein. Importance: To investigate how evolution might have impacted the host-canine distemper virus (CDV) interaction, we examined the functional properties of naturally occurring single nucleotide polymorphisms (SNPs) in the hemagglutinin gene of two related but distinct strains of CDV. The hemagglutinin gene encodes the attachment protein, which is pivotal for infection. Our results show that few SNPs have a relevant detrimental impact and they generally appear in specific combinations (molecular signatures). These drastic negative changes are neutralized by compensatory mutations, which contribute to maintenance of an overall constant bioactivity of the attachment protein. This compensational mechanism might reflect the reaction of the CDV machinery to the changes occurring in the virus following antigenic variations critical for virulence.

Characterization of Chelonus inanitus polydnavirus segments: sequences and analysis, excision site and demonstration of clustering

Polydnaviruses (genera Ichnovirus and Bracovirus) have a segmented genome of circular double-stranded DNA molecules, replicate in the ovary of parasitic wasps and are essential for successful parasitism of the host. Here we show the first detailed analysis of various segments of a bracovirus, the Chelonus inanitus virus (CiV). Four segments were sequenced and two of them, CiV12 and CiV14, were found to be closely related while CiV14.5 and CiV16.8 were unrelated. CiV12, CiV14.5 and CiV16.8 are unique while CiV14 occurs also nested in another larger segment. All four segments are predicted to contain genes and predictions could be substantiated in most cases. Comparison with databases revealed no significant similarities at either the nucleotide or amino acid level. Inverted repeats with identities between 77% and 92% and lengths between 26 bp and 100 bp were found on all segments outside of predicted genes. Hybridization experiments indicate that CiV12 and CiV14 are both flanked by other virus segments, suggesting that proviral CiV segments are clustered in the genome of the wasp. The integration/excision site of CiV14 was analysed and compared to that of CiV12. On both termini of proviral CiV12 and CiV14 as well as in the excised circular molecule and the rejoined DNA a very similar repeat of 14 bp was found. A model to illustrate where the terminal repeats might recombine to yield the circular molecule is presented. Excision of CiV12 and CiV14 is restricted to the female and sets in at a very specific time-point in pupal-adult development.

Conserved sequences and cell-specific DNase I hypersensitive sites upstream from the co-ordinately expressed alpha I- and alpha II-globin genes of Xenopus laevis

The globin gene family of Xenopus laevis comprises pairs of closely related genes that are arranged in two clusters, each pair of genes being co-ordinately and stage-specifically expressed. To get information on putative regulatory elements, we compared the DNA sequences and the chromatin conformation 5' to the co-ordinately expressed adult alpha-globin genes. Sequence analysis revealed a relatively conserved region from the cap site up to position -289, and further upstream seven distinct boxes of homology, separated by more diverged sequences or deletions/insertions. The homology boxes comprise 22 to 194 base-pairs showing 78 to 95% homology. Analysis of chromatin conformation showed that DNase I preferentially cuts the upstream region of both genes at similar positions, 5' to the T-A-T-A and the C-C-A-A-T boxes, only in chromatin of adult erythroblasts and erythrocytes, where adult globin genes are expressed, but not in chromatin of adult liver cells or larval erythrocytes, where these genes are silent. This suggests that cell- and stage-specific activation of these genes coincides with specific changes in chromatin conformation within the proximal upstream region. No difference was found in the nucleotide sequence within the DNase I hypersensitive region proximal to the adult alpha 1-globin gene in DNA from embryonic cells, in which this gene is inactive, and adult erythrocytes, expressing this gene.

Retinoic acid receptor beta and angiopoietin-like protein 1 are involved in the regulation of human androgen biosynthesis

Androgens are essential for sexual development and reproduction. However, androgen regulation in health and disease is poorly understood. We showed that human adrenocortical H295R cells grown under starvation conditions acquire a hyperandrogenic steroid profile with changes in steroid metabolizing enzymes HSD3B2 and CYP17A1 essential for androgen production. Here we studied the regulatory mechanisms underlying androgen production in starved H295R cells. Microarray expression profiling of normal versus starved H295R cells revealed fourteen differentially expressed genes; HSD3B2, HSD3B1, CYP21A2, RARB, ASS1, CFI, ASCL1 and ENC1 play a role in steroid and energy metabolism and ANGPTL1, PLK2, DUSP6, DUSP10 and FREM2 are involved in signal transduction. We discovered two new gene networks around RARB and ANGPTL1, and show how they regulate androgen biosynthesis. Transcription factor RARB stimulated the promoters of genes involved in androgen production (StAR, CYP17A1 and HSD3B2) and enhanced androstenedione production. For HSD3B2 regulation RARB worked in cooperation with Nur77. Secretory protein ANGPTL1 modulated CYP17A1 and DUSP6 expression by inducing ERK1/2 phosphorylation. By contrast, our studies revealed no evidence for hormones or cell cycle involvement in regulating androgen biosynthesis. In summary, these studies establish a firm role for RARB and ANGPTL1 in the regulation of androgen production in H295R cells.

Correction of aberrant FGFR1 RNA splicing through blocking intronic regulatory elements

Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^

From protein microarray to biology: The discovery of epigenetic regulatory molecules

Chromatin, composed of repeating nucleosome units, is the genetic polymer of life. To aid in DNA compaction and organized storage, the double helix wraps around a core complex of histone proteins to form the nucleosome, and is therefore no longer freely accessible to cellular proteins for the processes of transcription, replication and DNA repair. Over the course of evolution, DNA-based applications have developed routes to access DNA bound up in chromatin, and further, have actually utilized the chromatin structure to create another level of complexity and information storage. The histone molecules that DNA surrounds have free-floating tails that extend out of the nucleosome. These tails are post-translationally modified to create docking sites for the proteins involved in transcription, replication and repair, thus providing one prominent way that specific genomic sequences are accessed and manipulated. Adding another degree of information storage, histone tail-modifications paint the genome in precise manners to influence a state of transcriptional activity or repression, to generate euchromatin, containing gene-dense regions, or heterochromatin, containing repeat sequences and low-density gene regions. The work presented here is the study of histone tail modifications, how they are written and how they are read, divided into two projects. Both begin with protein microarray experiments where we discover the protein domains that can bind modified histone tails, and how multiple tail modifications can influence this binding. Project one then looks deeper into the enzymes that lay down the tail modifications. Specifically, we studied histone-tail arginine methylation by PRMT6. We found that methylation of a specific histone residue by PRMT6, arginine 2 of H3, can antagonize the binding of protein domains to the H3 tail and therefore affect transcription of genes regulated by the H3-tail binding proteins. Project two focuses on a protein we identified to bind modified histone tails, PHF20, and was an endeavor to discover the biological role of this protein. Thus, in total, we are looking at a complete process: (1) histone tail modification by an enzyme (here, PRMT6), (2) how this and other modifications are bound by conserved protein domains, and (3) by using PHF20 as an example, the functional outcome of binding through investigating the biological role of a chromatin reader. ^

Control of the master virulence regulatory gene atxA in Bacillus anthracis

Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule are positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In batch culture, multiple signals impact atxA transcript levels, and the timing and steady state level of atxA expression is critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to directly interact with the atxA promoter. The AbrB-binding site has been described, but additional cis-acting control sequences have not been defined. Using transcriptional lacZ fusions, electrophoretic mobility shift assays, and Western blot analysis, the cis-acting elements and trans-acting factors involved in regulation of atxA in B. anthracis strains containing either both virulence plasmids, pXO1 and pXO2, or only one plasmid, pXO1, were studied. This work demonstrates that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA, and an A+T-rich upstream element (UP-element) for RNA polymerase (RNAP). In addition, the data show that a trans-acting protein(s) other than AbrB negatively impacts atxA transcription when it binds specifically to a 9-bp palindrome within atxA promoter sequences located downstream of P1. Mutation of the palindrome prevents binding of the trans-acting protein(s) and results in a corresponding increase in AtxA and anthrax toxin production in a strain- and culture-dependent manner. The identity of the trans-acting repressor protein(s) remains elusive; however, phenotypes associated with mutation of the repressor binding site have revealed that the trans-acting repressor protein(s) indirectly controls B. anthracis development. Mutation of the repressor binding site results in misregulation and overexpression of AtxA in conditions conducive for development, leading to a marked sporulation defect that is both atxA- and pXO2-61-dependent. pXO2-61 is homologous to the sensor domain of sporulation sensor histidine kinases and is proposed to titrate an activating signal away from the sporulation phosphorelay when overexpressed by AtxA. These results indicate that AtxA is not only a master virulence regulator, but also a modulator of proper B. anthracis development. Also demonstrated in this work is the impact of the developmental regulators AbrB, Spo0A, and SigH on atxA expression and anthrax toxin production in a genetically incomplete (pXO1+, pXO2-) and genetically complete (pXO1+, pXO2+) strain background. AtxA and anthrax toxin production resulting from deletion of the developmental regulators are strain-dependent suggesting that factors on pXO2 are involved in control of atxA. The only developmental deletion mutant that resulted in a prominent and consistent strain-independent increase in AtxA protein levels was an abrB-null mutant. As a result of increased AtxA levels, there is early and increased production of anthrax toxins in an abrB-null mutant. In addition, the abrB-null mutant exhibited an increase in virulence in a murine model for anthrax. In contrast, virulence of the atxA promoter mutant was unaffected in a murine model for anthrax despite the production of 5-fold more AtxA than the abrB-null mutant. These results imply that AtxA is not the only factor impacting pathogenesis in an abrB-null mutant. Overall, this work highlights the complex regulatory network that governs expression of atxA and provides an additional role for AtxA in B. anthracis development.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Molecular and genetic analysis of Myxococcus xanthus early *development

To identify more mutations that can affect the early development of Myxococcus xanthus, the synthetic transposon TnT41 was designed and constructed. By virtue of its special features, it can greatly facilitate the processes of mutation screening/selection, mapping, cloning and DNA sequencing. In addition, it allows for the systematic discovery of genes in regulatory hierarchies using their target promoters. In this study, the minimal regulatory region of the early developmentally regulated gene 4521 was used as a reporter in the TnT41 mutagenesis. Both positive (P) mutations and negative (N) mutations were isolated based on their effects on 4521 expression.^ Four of these mutations, i.e. N1, N2, P52 and P54 were analyzed in detail. Mutations N1 and N2 are insertion mutations in a gene designated sasB. The sasB gene is also identified in this study by genetic and molecular analysis of five UV-generated 4521 suppressor mutations. The sasB gene encodes a protein without meaningful homology in the databases. The sasB gene negatively regulates 4521 expression possibly through the SasS-SasR two component system. A wild-type sasB gene is required for normal M. xanthus fruiting body formation and sporulation.^ Cloning and sequencing analysis of the P52 mutation led to the identification of an operon that encodes the M. xanthus high-affinity branched-chain amino acid transporter system. This liv operon consists of five genes designated livK, livH, livM, livC, and livF, respectively. The Liv proteins are highly similar to their counterparts from other bacteria in both amino acid sequences, functional motifs and predicted secondary structures. This system is required for development since liv null mutations cause abnormality in fruiting body formation and a 100-fold decrease in sporulation efficiency.^ Mutation P54 is a TnT41 insertion in the sscM gene of the ssc chemotaxis system, which has been independently identified by Dr. Shi's lab. The sscM gene encodes a MCP (methyl-accepting chemotaxis protein) homologue. The SscM protein is predicted to contain two transmembrane domains, a signaling domain and at least one putative methylation site. Null mutations of this gene abolish the aggregation of starving cells at a very early stage, though the sporulation levels of the mutant can reach 10% that of wild-type cells. ^

DNA alignment and Bayesian trees of partial sequences of COI, COIII and the haemocyanin functional unit f-g of 28 octopod species

Background: Octopods have successfully colonised the world's oceans from the tropics to the poles. Yet, successful persistence in these habitats has required adaptations of their advanced physiological apparatus to compensate impaired oxygen supply. Their oxygen transporter haemocyanin plays a major role in cold tolerance and accordingly has undergone functional modifications to sustain oxygen release at sub-zero temperatures. However, it remains unknown how molecular properties evolved to explain the observed functional adaptations. We thus aimed to assess whether natural selection affected molecular and structural properties of haemocyanin that explains temperature adaptation in octopods. Results: Analysis of 239 partial sequences of the haemocyanin functional units (FU) f and g of 28 octopod species of polar, temperate, subtropical and tropical origin revealed natural selection was acting primarily on charge properties of surface residues. Polar octopods contained haemocyanins with higher net surface charge due to decreased glutamic acid content and higher numbers of basic amino acids. Within the analysed partial sequences, positive selection was present at site 2545, positioned between the active copper binding centre and the FU g surface. At this site, methionine was the dominant amino acid in polar octopods and leucine was dominant in tropical octopods. Sites directly involved in oxygen binding or quaternary interactions were highly conserved within the analysed sequence. Conclusions: This study has provided the first insight into molecular and structural mechanisms that have enabled octopods to sustain oxygen supply from polar to tropical conditions. Our findings imply modulation of oxygen binding via charge-charge interaction at the protein surface, which stabilize quaternary interactions among functional units to reduce detrimental effects of high pH on venous oxygen release. Of the observed partial haemocyanin sequence, residue 2545 formed a close link between the FU g surface and the active centre, suggesting a role as allosteric binding site. The prevalence of methionine at this site in polar octopods, implies regulation of oxygen affinity via increased sensitivity to allosteric metal binding. High sequence conservation of sites directly involved in oxygen binding indicates that functional modifications of octopod haemocyanin rather occur via more subtle mechanisms, as observed in this study.