997 resultados para Normal Forms
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.
Resumo:
Sphingolipids are widely expressed molecules, which traditionally were considered to have majorly structural properties. Nowadays, however, they are implicated in a wide range of different biological processes. The bioactive lipid sphingosine 1-phosphate (S1P) has emerged during the past decade as one of the most studied molecules due to its proliferative and pro-migratory abilities both during normal physiology and in the pathology of a subset of different diseases. Migration and invasion of cancer cells require changes in cell behavior and modulation of the tissue microenvironment. Tumor aggressiveness is markedly enhanced by hypoxia, in which hypoxia inducible transcription factors 1-2α (HIF-1-2α) are activated to promote metabolism, proliferation and migration. Invasion requires degradation of the extracellular matrix (ECM) achieved by several degrading and remodeling enzymes. Matrix metalloproteinases (MMPs) are broadly expressed and well accepted as proteolytic enzymes with essential roles both in normal physiology and in pathology. Previously, S1P was shown to strongly evoke migration of follicular ML-1 thyroid cancer cells. The objective of this study was to further investigate and understand the mechanisms behind this regulation. In the first project it was demonstrated that S1P enhances the expression and activity of HIF-1α. S1P enhanced the expression of HIF-1α by increasing its synthesis and stability. The S1P-increased HIF-1α was mediated via S1P3, Gi/0, PI3K, PKCβI, ERK1/2, mTOR and translation factors p70S6K and eIF4E. Finally, it was shown that HIF-1α mediated S1P-induced migration. The ECM is constituted of a complex and coordinated assembly of many types of proteins. In order to be able to invade, cells need to break down the ECM, therefore several key players in this event were investigated in the second project. S1P increased the secretion and activity of MMP2 and MMP9 via S1P-receptor 1 and 3 and that these MMPs participated in the S1P-facilitated invasion of ML-1 cells. In this interplay, calpains and Rac1 were involved, both of which are crucial players in migration and invasion. The prognosis for some types of thyroid cancer is relatively good. However, there are forms of thyroid cancers, for which there are no treatments or the current available treatments are inefficient. Thus, new medical interventions are urgently needed. In the third project the significance of the S1P-receptor modulating drug FTY720, which is currently used for the treatment of multiple sclerosis (MS), was studied. The effect of FTY720 was tested on several thyroid cancer cell lines, and it inhibited the proliferation and invasion of all cancer cell lines tested. In ML-1 cells, FTY720 attenuated invasion by blocking signaling intermediates important for migration and invasion of the cells. Moreover, FTY720 inhibited the proliferation of ML-1 cells by increasing the expression of p21 and p27, hence, inducing cell arrest in G1 phase of the cell cycle. Thus, it can be suggested that FTY720 could be used in the treatment of thyroid cancer.
Resumo:
Kollaasi Salomea esittäneistä oopperalaulajista: Henny Dima, Josephine von Hubbenet, Fanchette Verhunk, Signe von Rappe, Mme. Isnardon, Agnes Klebe, Malvine Kann, Kruszelnicka, Aino Ackté, Emma Destinn, Anna Sutter, Thyra Larsen.
Resumo:
O objetivo do presente trabalho foi estudar os efeitos das gomas guar e xantana sobre a estabilidade dos géis de amido de milho normal, ceroso e com alto teor de amilose submetidos aos processos de congelamento e descongelamento. Os géis desses amidos, com concentração total de sólidos de 10% e adicionados das gomas (0,15; 0,50; 0,85 e 1%), foram submetidos a 5 ciclos de congelamento (20 horas a -18 °C) e descongelamento (4 horas a 25 °C), com exceção dos géis com alto teor de amilose, que foram submetidos a apenas 1 ciclo, devido à perda da estrutura de gel. A determinação da sinérese (porcentagem de água liberada) foi realizada pela diferença entre a massa inicial e a massa final das amostras. O gel de amido de milho normal liberou 74,45% de água, sendo que a adição de 1% da goma xantana reduziu significativamente a sinérese para 66,43%. A adição de 0,85 e 1% da goma xantana também reduziu a sinérese dos géis de amido ceroso. O menor teor de sinérese foi obtido com a utilização de 1% de goma xantana ao gel de amido de milho com alto teor de amilose, evidenciando a ação crioprotetora desta goma.
Resumo:
Foram elaborados hambúrgueres e filés empanados com peitos de frango pálidos e normais e foram realizadas as seguintes análises de qualidade: cor, Perda de Peso por Cozimento (PPC), cisalhamento, Encolhimento por Fritura (EF), TBA, avaliação microbiológica e sensorial para os hambúrgueres, e TBA, análise microbiológica e análise sensorial para os filés empanados. As amostras de hambúrgueres elaboradas não diferiram significativamente (p > 0,05) nos parâmetros de coloração, EF, PPC e análise microbiológica e sensorial. Para análise de força de cisalhamento, houve diferença significativa (p < 0,05) entre os hambúrgueres no período de 7, 60 e 120 dias, sendo que os hambúrgueres elaborados com carne pálida (1,92; 1,31 e 1,46, respectivamente) apresentaram as menores médias quando comparados com os de carne normal (2,34; 1,85 e 1,73, respectivamente). Na análise de TBA, as amostras elaboradas com carne pálida também tiveram os maiores resultados com 90 a 180 dias de estocagem (5,28; 7,78; 8,89; 5,02) quando comparadas às de carne normal (2,62; 7,05; 8,08; 3,89). Para os filés empanados, não foram encontradas diferenças significativas (p > 0,05) entre a elaboração com carne de coloração normal e pálida para os parâmetros avaliados. Estes resultados demonstram que a carne pálida pode ser utilizada para a elaboração de produtos industrializados sem causar prejuízos em sua qualidade.
Resumo:
O objetivo do presente estudo foi avaliar os amidos de milho normal, ceroso e com alto teor de amilose, fabricados pela National Starch, por meio da determinação das suas características físico-químicas, morfológicas, térmicas e reológicas. O amido de milho com alto teor de amilose (AM) apresentou teor de amilose igual a 71%, sendo que os valores obtidos para o amido de milho normal (M) e o amido de milho ceroso (AP) foram de 27,8 e 1,8%, respectivamente. Traços de proteína e lipídios foram encontrados nas amostras. O amido de milho ceroso apresentou maior viscosidade máxima e uma menor tendência à retrogradação, se comparado ao amido de milho normal. O amido AP apresentou menor entalpia de gelatinização, como pode ser observado nas análises de calorimetria exploratória diferencial (DSC), na qual a temperatura de gelatinização foi de 75 °C e o ΔH de 3,34 J.g-1, e também na análise de RVA (Rapid Visco Analyser), em que a temperatura de pasta foi de 71 °C. Apresentando, dessa forma, valores inferiores aos verificados para os outros amidos. O valor do ΔH de retrogradação do amido AP, mostrou-se 25,8% inferior ao ΔH do amido M. O amido AM apresentou o valor de 26,38 J.g-1, demonstrando o maior envolvimento da molécula de amilose no processo de retrogradação. Isso também foi evidenciado pela medida da força dos géis: o gel de AM apresentou força 99,18% superior, retrogradando mais que os outros amidos. As análises de difração de raio X mostraram que os amidos de milho normal e ceroso apresentaram um padrão de difração do tipo A e o amido de milho com alto teor de amilose apresentou padrão do tipo B.
Retenção de aroma na secagem em atmosferas normal e modificada: desenvolvimento do sistema de estudo
Resumo:
Na secagem de determinados alimentos, como frutas, juntamente com a água há também a evaporação de outras substâncias voláteis presentes em quantidades menores. Por isso, torna-se interessante considerar nos estudos de secagem a evaporação, além da água, desses outros componentes voláteis. A modificação da atmosfera tem sido utilizada em armazenamento, principalmente de vegetais, mas pode também ser estendida à secagem, pois pode influenciar a perda de voláteis responsáveis pelas características sensoriais do produto final. No presente trabalho, é apresentado um sistema de secagem previamente desenvolvido, no qual a atmosfera de secagem pode ser modificada pela adição de gases ou líquidos. Desenvolveu-se um sistema-modelo a partir da composição química básica do abacaxi e da adição de outros compostos, contendo um dos principais componentes do aroma desta fruta (hexanoato de etila). Além disso, também foi desenvolvida a metodologia analítica de determinação do aroma no sistema-modelo e no abacaxi, a partir dos estudos de extração de aromas e de análise cromatográfica gasosa. O aroma presente no sistema-modelo foi extraído em hexano e os componentes voláteis do aroma do abacaxi foram extraídos em éter etílico
Resumo:
The objective of this study was to evaluate the influence of vitamin C (VC), vitamin E (VE), and two selenium sources on the performance, yield, and composition of Nile tilapia fillet. The experiment was conducted in a completely randomized design consisting of six treatments with the addition of 100, 200, and 400 mg kg-1 VC and VE and 0.1, 0.2, and 0.4 of two sources of selenium. Each treatment had five replicates of 30 fish each. The diet with 200 mg kg-1 VC and VE + 0.2 mg.k-1 organic selenium resulted in weight gain, length gain, and feed conversion ratio similar to that of the treatment with 400 mg kg-1 VC and VE + 0.4 mg kg-1 organic or inorganic selenium. The addition of organic selenium to the diet improved the weight gain and feed conversion ratio in comparison with the addition of inorganic selenium. The diet with 0.2 mg kg-1 organic selenium showed glutathione peroxidase level equal to the diet with 0.4 mg kg-1 of inorganic selenium. Carcass and fillet yields were not affected by treatments; however, there was treatment effect on the fillet's chemical composition.
Resumo:
Yrityksen selviytyminen ja menestyminen ovat riippuvaisia sen kyvystä innovoida, luoda tietoa ja hyödyntää tietämystä ja keksintöjä (Dunk ja Kilgore 2001). Yrityksen menestyminen erityisesti korkean teknologian alalla on siten suoraan riippuvainen sen T&T:stä, johon tehdyt investoinnit tuovat merkittäviä taloudellisia etuja yritykselle uusien tuotteiden, palveluiden ja prosessien muodossa (McEvily ja Chakravarthy 1999). Teknologinen etumatka ja sen tuotteistaminen innovatiivisiksi tarjoamiksi mahdollistaa monopolististen etujen saavuttamisen yrityksen kansainvälisessä kilpailussa (Lall 1977). Tämä kaltainen kilpailuetu voidaan saavuttaa yrityksen kyvyllä yhdistää maantieteellisesti hajautettu T&T:nsä tehokkaaksi verkostoksi (Porter 1986). Boehen (2008) mukaan T&T:n globalisoitumista voidaan johtaa eri hallintömuodoilla: T&T:n kansainvälistymisellä, T&T:n ulkomaille sijoittamisella ja T&T ulkomaille ulkoistamisella. T&T:n globalisoituminen on osa 2000-luvun taloudellista muutosta, ja sille on esitetty useita vaikuttavia tekijöitä, kuten kustannuserot, työvoimaresurssit, erityisosaamiskeskukset, paikallinen teknologia osaaminen ja kohdemarkkinoiden potentiaali (bardhan 2006; Norwood, ym. 2006; von Zedtwitz ja Gassmann 2002). Tutkimuksen on osoitettu eroavan tuotekehityksestä ja eri tekijöiden on osoitettu vaikuttavan niihin (von Zedtwitz ja Gassmann 2002; Leifer ja Triscari 1987). Samoin T&T on osoitettu olevan jatkumo perustavanlaatuisesta soveltavaan ja lääkekehityksen muodostavan vastaavan T&T jatkumon (Lall 1980; Iansiti 1993), jonka yksittäiset osat vaikuttavat sen hallintomuotoon. Tutkimus esittää eri tekijöitä voivan hyödyntää hallintomuodosta riippuen. Tätä tutkimusta varten tutkija haastatteli lääketeollisuuden johtajia Kiinassa vahvistaakseen tai hylätäkseen eri tekijöitä ja niiden suhdetta lääketeollisen T&T:n hallintomuotoihin. Markkinoiden todettiin olevan ensisijainen tekijä mutta myös kustannuserojen, insentiivien, työvoimaresurssien ja erityisosaamiskeskusten merkitys T&T:n globalisoitumiseen vaikuttavina tekijöinä vahvistettiin yhdessä perusvaatimusten ja riskitekijöiden kanssa. Tutkimuksessa vahvistetaan myös lääketeollisen T&T-jatkumon vaikutus ja esitetään viitekehys hallintomuodoille.
Resumo:
Firm's survival and success, which are dependent on its ability to innovate, to create knowledge and to capitalize on inventions and know-how, is in essence directly linked to its R&D process (Dunk and Kilgore 2001). Especially in technology driven industries, such as the pharmaceuticals, there are significant positive returns to R&D investments through introduction of new or improved products and services (McEvily and Chakravarthy 1999). Technological lead and its transformation to innovative products as fruits of corporate R&D can be seen as monopolistic advantage that helps enterprises to compete in today’s market (Lall 1977). This competitive advantage can be derived from corporation's ability to integrate its activities across geographic locations (Porter 1986). According to Boehe (2008) globalization of R&D can executed with different governance forms: R&D internationalization, R&D offshoring or R&D offshore outsourcing. Globalization of R&D is intervened with the changes in global economy of the 21st century. Some studies argue for its influencing factors to be access to vast skilled labor pools and centers of excellence (Bardhan 2006). Other studies indicate the R&D cost differentials between countries to be the major expected benefit (Norwood et al. 2006). Von Zedtwitz and Gassmann (2002) presented benefits as divided to accessing markets and customers or to accessing local science and technology. This study proposes that based on governance form distinct factor derived benefits can be capitalized. To corroborate or refute factors and their relations on R&D globalization governance forms, an empirical study based on expert interviews of pharmaceutical directors was conducted in the People's Republic of China. The market was found to be the major influencing factor. Local requirements and adaptation were corroborated as factors connected with markets. Furthermore, influencing factors, such as labour, centers of excellence, cost, financial incentives were corroborated together with conditional and risk factors. Furthermore this research argues that the globalization of pharmaceutical R&D is dependent on the financial, scientific and operational requirements of the drug discovery stage. And thus establishes the influence of drug discovery's stages continuum on pharmaceutical R&D globalization. Finally, a R&D globalization governance form decision framework is proposed based on the frameworks presented in literature and author's corroborated empirical findings.
Resumo:
[Ecole polytechnique]