980 resultados para HUMAN POSTURAL CONTROL


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cervical cancer is a major source of illness and death among women worldwide and genital infection with oncogenic human papillomavirus (HPV) its principal cause. There is evidence of the influence of the male factor in the development of cervical neoplasia. Nevertheless, the pathogenic processes of HPV in men are still poorly understood. It has been observed that different HPV types can be found among couples. The objective of the present study was to investigate HPV infections in female patients (n = 60 females/group) as well as in their sexual partners and to identify the concordance of HPV genotypes among them. By using the polymerase chain reaction, we detected a 95% prevalence of HPV DNA in women with cervical intraepithelial neoplasia (CIN) compared to 18.3% in women with normal cervical epithelium, with a statistically significant difference (P < 0.001). The HPV DNA prevalence was 50% in male partners of women with CIN and 16.6% in partners of healthy women. In the control group (healthy women), only 9 couples were simultaneously infected with HPV, and only 22.2% of them had the same virus type, showing a weak agreement rate (kappa index = 0.2). Finally, we observed that HPV DNA was present in both partners in 30 couples if the women had CIN, and among them, 53.3% shared the same HPV type, showing moderate agreement, with a kappa index of 0.5. This finding supports the idea of circulation and recirculation of HPV among couples, perpetuating HPV in the sexually active population, rather than true recurrences of latent infections.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In addition to methylated cytosines (5-mCs), hydroxymethylcytosines (5-hmCs) are present in CpG dinucleotide-enriched regions and some transcription regulator binding sites. Unlike methylation, hydroxymethylation does not result in silencing of gene expression, and the most commonly used methods to study methylation, such as techniques based on restriction enzymatic digestion and/or bisulfite modification, are unable to distinguish between them. Genomic imprinting is a process of gene regulation where only one member of an allelic pair is expressed depending on the parental origin. Chromosome 11p15.5 has an imprinting control region (ICR2) that includes a differentially methylated region (KvDMR1) that guarantees parent-specific gene expression. The objective of the present study was to determine the presence of 5-hmC at the KvDMR1 in human placentas. We analyzed 16 third-trimester normal human placentas (chorionic villi). We compared two different methods based on real-time PCR after enzymatic digestion. The first method distinguished methylation from hydroxymethylation, while the other method did not. Unlike other methylation studies, subtle variations of methylation in ICRs could represent a drastic deregulation of the expression of imprinted genes, leading to important phenotypic consequences, and the presence of hydroxymethylation could interfere with the results of many studies. We observed agreement between the results of both methods, indicating the absence of hydroxymethylation at the KvDMR1 in third-trimester placentas. To the best of our knowledge, this is the first study describing the investigation of hydroxymethylation in human placenta using a genomic imprinting model.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

β-arrestins are expressed proteins that were first described, and are well-known, as negative regulators of G protein-coupled receptor signaling. Penehyclidine hydrochloride (PHC) is a new anti-cholinergic drug that can inhibit biomembrane lipid peroxidation, and decrease cytokines and oxyradicals. However, to date, no reports on the effects of PHC on β-arrestin-1 in cells have been published. The aim of this study was to investigate the effect of PHC on β-arrestin-1 expression in lipopolysaccharide (LPS)-induced human pulmonary microvascular endothelial cells (HPMEC). Cultured HPMEC were pretreated with PHC, followed by LPS treatment. Muscarinic receptor mRNAs were assayed by real-time quantitative PCR. Cell viability was assayed by the methyl thiazolyl tetrazolium (MTT) conversion test. The dose and time effects of PHC on β-arrestin-1 expression in LPS-induced HPMEC were determined by Western blot analysis. Cell malondialdehyde (MDA) level and superoxide dismutase (SOD) activity were measured. It was found that the M3 receptor was the one most highly expressed, and was activated 5 min after LPS challenge. Furthermore, 2 μg/mL PHC significantly upregulated expression of β-arrestin-1 within 10 to 15 min. Compared with the control group, MDA levels in cells were remarkably increased and SOD activities were significantly decreased in LPS pretreated cells, while PHC markedly decreased MDA levels and increased SOD activities. We conclude that PHC attenuated ROS injury by upregulating β-arrestin-1 expression, thereby implicating a mechanism by which PHC may exert its protective effects against LPS-induced pulmonary microvascular endothelial cell injury.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Sucrose solution is recommended as relevant pain relief management in neonates during acute painful procedures; however, only a few studies have analyzed the potentially adverse effects of sucrose administration to preterm neonates. The goal of this study was to examine the potential side effects of sucrose for pain relief in preterm infants, assessing feeding and weight gain during hospitalization and their feeding patterns postdischarge. The study sample consisted of 43 preterm neonates divided into two groups: a sucrose group (SG, n=18) and a control group (CG, n=25) in which no sucrose was administered. The SG received 0.5 mL/kg 25% oral sucrose for 2 min prior to all acute painful procedures during three consecutive days. A prospective review of medical charts was performed for all samples. The study was done prior to implementation of the institutional sucrose guidelines as a routine service, and followed all ethical requirements. There were no statistically significant differences between groups in terms of weight gain, length of stay with orogastric tubes, and parenteral feeding. Postdischarge, infant nutritional intake included feeding human milk to 67% of the SG and 74% of the CG. There were no statistically significant differences between groups regarding human milk feeding patterns postdischarge. Neonate feeding patterns and weight gain were unaffected following the short-term use of sucrose for pain relief.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

β-catenin and c-myc play important roles in the development of tissues and organs. However, little is known about their expression patterns during the development of the human common bile duct. Immunohistochemistry was used to detect β-catenin and c-myc expression in common bile duct samples from postmortem tissues of 14 premature infants and 6 spontaneously aborted fetuses. The expression of β-catenin and c-myc was also analyzed by Western blot. The samples were divided into four groups based on the stage of human fetal development: 12, 13-27, 28-37, and >37 weeks. The Image-Pro Plus v. 6.0 image analysis software was used to calculate the mean qualifying score (MQS). At fetal stages 12, 13-27, 28-37, and >37 weeks, MQS of β-catenin were 612.52±262.13, 818.38±311.73, 706.33±157.19, and 350.69±110.19, respectively. There was a significant difference in MQS among the four groups (ANOVA, P=0.0155) and between the scores at >37 and 13-27 weeks (Student-Newman-Keuls, P<0.05). At fetal stages 12, 13-27, 28-37, and >37 weeks, the MQS of c-myc were 1376.64±330.04, 1224.18±171.66, 1270.24±320.75, and 741.04±219.19, respectively. There was a significant difference in MQS among the four groups (ANOVA, P=0.0087) and between the scores at >37 and 12 weeks, >37 and 13-27 weeks, and >37 and 28-37 weeks (all P<0.05, Student-Newman-Keuls). Western blots showed that β-catenin and c-myc expression were significantly higher in fetal than in postnatal control duct tissue (P<0.05). c-myc and β-catenin are involved in the normal development of the human common bile duct.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The physiological mechanisms involved in isoproterenol (ISO)-induced chronic heart failure (CHF) are not fully understood. In this study, we investigated local changes in cardiac aldosterone and its synthase in rats with ISO-induced CHF, and evaluated the effects of treatment with recombinant human brain natriuretic peptide (rhBNP). Sprague-Dawley rats were divided into 4 different groups. Fifty rats received subcutaneous ISO injections to induce CHF and the control group (n=10) received equal volumes of saline. After establishing the rat model, 9 CHF rats received no further treatment, rats in the low-dose group (n=8) received 22.5 μg/kg rhBNP and those in the high-dose group (n=8) received 45 μg/kg rhBNP daily for 1 month. Cardiac function was assessed by echocardiographic and hemodynamic analysis. Collagen volume fraction (CVF) was determined. Plasma and myocardial aldosterone concentrations were determined using radioimmunoassay. Myocardial aldosterone synthase (CYP11B2) was detected by quantitative real-time PCR. Cardiac function was significantly lower in the CHF group than in the control group (P<0.01), whereas CVF, plasma and myocardial aldosterone, and CYP11B2 transcription were significantly higher than in the control group (P<0.05). Low and high doses of rhBNP significantly improved hemodynamics (P<0.01) and cardiac function (P<0.05) and reduced CVF, plasma and myocardial aldosterone, and CYP11B2 transcription (P<0.05). There were no significant differences between the rhBNP dose groups (P>0.05). Elevated cardiac aldosterone and upregulation of aldosterone synthase expression were detected in rats with ISO-induced CHF. Administration of rhBNP improved hemodynamics and ventricular remodeling and reduced myocardial fibrosis, possibly by downregulating CYP11B2 transcription and reducing myocardial aldosterone synthesis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Bone homeostasis seems to be controlled by delicate and subtle “cross talk” between the nervous system and “osteo-neuromediators” that control bone remodeling. The purpose of this study was to evaluate the effect of interactions between neuropeptides and human bone morphogenetic protein 2 (hBMP2) on human osteoblasts. We also investigated the effects of neuropeptides and hBMP2 on gap junction intercellular communication (GJIC). Osteoblasts were treated with neuropeptide Y (NPY), substance P (SP), or hBMP2 at three concentrations. At various intervals after treatment, cell viability was measured by the MTT assay. In addition, cellular alkaline phosphatase (ALP) activity and osteocalcin were determined by colorimetric assay and radioimmunoassay, respectively. The effects of NPY, SP and hBMP on GJIC were determined by laser scanning confocal microscopy. The viability of cells treated with neuropeptides and hBMP2 increased significantly in a time-dependent manner, but was inversely associated with the concentration of the treatments. ALP activity and osteocalcin were both reduced in osteoblasts exposed to the combination of neuropeptides and hBMP2. The GJIC of osteoblasts was significantly increased by the neuropeptides and hBMP2. These results suggest that osteoblast activity is increased by neuropeptides and hBMP2 through increased GJIC. Identification of the GJIC-mediated signal transduction capable of modulating the cellular activities of bone cells represents a novel approach to studying the biology of skeletal innervation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Allogeneic mesenchymal stem cells (allo-MSCs) have recently garnered increasing interest for their broad clinical therapy applications. Despite this, many studies have shown that allo-MSCs are associated with a high rate of graft rejection unless immunosuppressive therapy is administered to control allo-immune responses. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) is a co-inhibitory molecule expressed on T cells that mediates the inhibition of T-cell function. Here, we investigated the osteogenic differentiation potency of allo-MSCs in an activated immune system that mimics the in vivo allo-MSC grafting microenvironment and explored the immunomodulatory role of the helper T cell receptorCTLA4 in this process. We found that MSC osteogenic differentiation was inhibited in the presence of the activated immune response and that overexpression of CTLA4 in allo-MSCs suppressed the immune response and promoted osteogenic differentiation. Our results support the application of CTLA4-overexpressing allo-MSCs in bone tissue engineering.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Sex hormones from environmental and physiological sources might play a major role in the pathogenesis of hepatoblastoma in children. This study investigated the effects of estradiol and bisphenol A on the proliferation and telomerase activity of human hepatoblastoma HepG2 cells. The cells were divided into 6 treatment groups: control, bisphenol A, estradiol, anti-estrogen ICI 182,780 (hereinafter ICI), bisphenol A+ICI, and estradiol+ICI. Cell proliferation was measured based on average absorbance using the Cell Counting-8 assay. The cell cycle distribution and apoptotic index were determined by flow cytometry. Telomerase activity was detected by polymerase chain reaction and a telomeric repeat amplification protocol assay. A higher cell density was observed in bisphenol A (P<0.01) and estradiol (P<0.05) groups compared with the control group. Cell numbers in S and G2/M phases after treatment for 48 h were higher (P<0.05), while the apoptotic index was lower (P<0.05) and telomerase activities at 48 and 72 h (P<0.05) were higher in these groups than in the control group. The cell density was also higher in bisphenol A+ICI (P<0.01) and estradiol+ICI (P<0.05) groups compared with the ICI group. Furthermore, cell numbers were increased in S and G2/M phases (P<0.05), while the apoptotic index was lower (P<0.05) and telomerase activities at 48 and 72 h were higher (P<0.05) in these groups than in the ICI group. Therefore, bisphenol A and estradiol promote HepG2 cell proliferation in vitro by inhibition of apoptosis and stimulation of telomerase activity via an estrogen receptor-dependent pathway.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This study aims to explore the effect of microRNA-21 (miR-21) on the proliferation of human degenerated nucleus pulposus (NP) by targeting programmed cell death 4 (PDCD4) tumor suppressor. NP tissues were collected from 20 intervertebral disc degeneration (IDD) patients, and from 5 patients with traumatic spine fracture. MiR-21 expressions were tested. NP cells from IDD patients were collected and divided into blank control group, negative control group (transfected with miR-21 negative sequences), miR-21 inhibitor group (transfected with miR-21 inhibitors), miR-21 mimics group (transfected with miR-21 mimics) and PDCD4 siRNA group (transfected with PDCD4 siRNAs). Cell growth was estimated by Cell Counting Kit-8; PDCD4, MMP-2,MMP-9 mRNA expressions were evaluated by qRT-PCR; PDCD4, c-Jun and p-c-Jun expressions were tested using western blot. In IDD patients, the expressions of miR-21 and PDCD4 mRNA were respectively elevated and decreased (both P<0.05). The miR-21 expressions were positively correlated with Pfirrmann grades, but negatively correlated with PDCD4 mRNA (both P<0.001). In miR-21 inhibitor group, cell growth, MMP-2 and MMP-9 mRNA expressions, and p-c-Jun protein expressions were significantly lower, while PDCD4 mRNA and protein expressions were higher than the other groups (all P<0.05). These expressions in the PDCD4 siRNA and miR-21 mimics groups was inverted compared to that in the miR-21 inhibitor group (all P<0.05). MiR-21 could promote the proliferation of human degenerated NP cells by targeting PDCD4, increasing phosphorylation of c-Jun protein, and activating AP-1-dependent transcription of MMPs, indicating that miR-21 may be a crucial biomarker in the pathogenesis of IDD.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The aim of this thesis is to propose a novel control method for teleoperated electrohydraulic servo systems that implements a reliable haptic sense between the human and manipulator interaction, and an ideal position control between the manipulator and the task environment interaction. The proposed method has the characteristics of a universal technique independent of the actual control algorithm and it can be applied with other suitable control methods as a real-time control strategy. The motivation to develop this control method is the necessity for a reliable real-time controller for teleoperated electrohydraulic servo systems that provides highly accurate position control based on joystick inputs with haptic capabilities. The contribution of the research is that the proposed control method combines a directed random search method and a real-time simulation to develop an intelligent controller in which each generation of parameters is tested on-line by the real-time simulator before being applied to the real process. The controller was evaluated on a hydraulic position servo system. The simulator of the hydraulic system was built based on Markov chain Monte Carlo (MCMC) method. A Particle Swarm Optimization algorithm combined with the foraging behavior of E. coli bacteria was utilized as the directed random search engine. The control strategy allows the operator to be plugged into the work environment dynamically and kinetically. This helps to ensure the system has haptic sense with high stability, without abstracting away the dynamics of the hydraulic system. The new control algorithm provides asymptotically exact tracking of both, the position and the contact force. In addition, this research proposes a novel method for re-calibration of multi-axis force/torque sensors. The method makes several improvements to traditional methods. It can be used without dismantling the sensor from its application and it requires smaller number of standard loads for calibration. It is also more cost efficient and faster in comparison to traditional calibration methods. The proposed method was developed in response to re-calibration issues with the force sensors utilized in teleoperated systems. The new approach aimed to avoid dismantling of the sensors from their applications for applying calibration. A major complication with many manipulators is the difficulty accessing them when they operate inside a non-accessible environment; especially if those environments are harsh; such as in radioactive areas. The proposed technique is based on design of experiment methodology. It has been successfully applied to different force/torque sensors and this research presents experimental validation of use of the calibration method with one of the force sensors which method has been applied to.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Iron bioavailability was evaluated in three mixtures of cereals, seeds, and grains ("Human Ration"): light, regular, and homemade provided to rats. The animals received an iron depletion diet for 21 days, followed by a repletion diet containing 12 mg·kg-1 of iron for 14 days. The hemoglobin regeneration efficiency and the relative biological value did not differ between the light mixture and control group. The iron bioavailability of the light mixture of cereals, seeds, and grains and the control group were 99.99±27.62 and 80.02±36.63, respectively, while the regular and homemade mixtures of cereals, seeds, and grains showed lower iron bioavailability, 50.12±35.53 and 66.66±15.44, respectively; the iron content of the diet with light cereal mixture light was statistically similar to that of the control (ferrous sulfate 99.99±27.62). The high content of tannin (202.81±19.53 mg·100-1) in the diet with the regular cereal mixture may have contributed to its low iron bioavailability. The higher intake of soluble fiber by the animals fed the light mixture (21.15±0.92 g) was moderately correlated (r=0.5712, p=0.0018) with the concentration of propionate in the caecal bulk (65.49±11.08 µmol/g). The short chain fatty acids produced by soluble fiber fermentation, associated with the low-content of tannin may have improved iron solubility and absorption in the light cereal mixture diet. The iron bioavailability in the light mixture of cereals, seeds, and grains was similar to that of ferrous sulfate.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Aims: The aim of this work was to assess the ultrastructural changes, cellular proliferation, and the biofilm formation ability of F. nucleatum as defense mechanisms against the effect of HNP-1. Materials and methods: The type strain of F. nucleatum (ssp. nucleatum ATCC 25586) and two clinical strains (ssp. polymorphum AHN 9910 and ssp. nucleatum AHN 9508) were cultured and incubated with four different test concentrations of recombinant HNP-1 (1, 5, 10 and 20 µg/ml) and one control group (0 µg/ml). Bacterial pellets from each concentration were processed for TEM imaging. Planktonic growth was assessed and colony forming units (CFU) were measured to determine the cellular proliferation. Scrambled HNP-1 was used for confirmation. Results: TEM analyses revealed a decrease in the outer membrane surface corrugations and roughness of the strain AHN 9508 with increasing HNP-1 concentrations. In higher concentrations of HNP-1, the strain AHN 9910 showed thicker outer membranes with a number of associated rough vesicles attached to the outer surface. For ATCC 25586, the treated bacterial cells contained higher numbers of intracellular granules with increasing the peptide concentration. Planktonic growth of the two clinical strains were significantly enhanced (P<0.001) with gradually increased concentrations of HNP-1. None of the planktonic growth results of the 3 strains incubated with the scrambled HNP-1 was statistically significant. HNP-1 decreased the biofilm formation of the two clinical strains, AHN 9910 and 9508, significantly (P<0.01 and P<0.001; respectively). Conclusions: The present in vitro study demonstrates that F. nucleatum has the ability to withstand the lethal effects of HNP-1 even at concentrations simulating the diseased periodontium in vivo. The increase in planktonic growth could act as defense mechanisms of F. nucleatum against HNP-1.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

AbstractIntroduction:Human immunodeficiency virus (HIV) the causative agent of Acquired immunodeficiency syndrome (AIDS) is an important cause of renal diseases in sub-Saharan Africa. There is paucity of studies on the burden of chronic kidney disease (CKD) among patients with HIV/AIDS in the North-Central zone of Nigeria.Methods:This is a cross-sectional study of 227 newly-diagnosed, antiretroviral naïve patients with HIV/AIDS seen at the HIV clinic of the Medical Out-patient Department (MOPD) of University of Ilorin Teaching Hospital (UITH). They were matched with 108 control group. Laboratory investigations were performed for the participants. CKD was defined as estimated glomerular filtration rate (eGFR) < 60 ml/min/1.73 m2 and/or albumin creatinine ratio (ACR) > 30 mg/g.Results:There were 100 (44%) males among the patients and 47 (43.5%) among the control group. The mean ages of the patients and controls were 40.3 ± 10.3 years and 41.8 ± 9.5 years respectively. CKD was observed in 108 (47.6%) among the patients and 18 (16.7%) of the controls (p = 0.01). The median CD4 T-cell count was significantly lower in patients with CKD. Ninety-three (41.0%) of the patients had dipstick proteinuria of > 2 +. The median albumin creatinine ratio (ACR) was significantly higher among the HIV-positive patients (272.3 mg/g) compared with the HIV-negative controls (27.22 mg/g) p = 0.01. The CD4 T-cell count correlates positively with eGFR (r = 0.463, p = 0.001) and negatively with ACR (r = -0.806, p = 0.001).Conclusions:CKD is very common among patients with HIV/AIDS in Ilorin. Screening and early intervention for CKD should be part of the protocols in the management of these patients.