Molecular adjuvant effects of a conformationally biased agonist elf human C5a anaphylatoxin

A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.

Evaluation of Maxillary Alveolar Reconstruction Using a Resorbable Collagen Sponge with Recombinant Human Bone Morphogenetic Protein-2 in Cleft Lip and Palate Patients

Introduction: A resorbable collagen matrix with recombinant human bone morphogenetic protein (rhBMP-2) was compared with traditional iliac crest bone graft for the closure of alveolar defects during secondary dental eruption. Methods: Sixteen patients with unilateral cleft lip and palate, aged 8 to 12 years, were selected and randomly assigned to group 1 (rhBMP-2) or group 2 (iliac crest bone graft). Computed tomography was performed to assess both groups preoperatively and at months 6 and 12 postoperatively. Bone height and defect volume were calculated through Osirix Dicom Viewer (Pixmeo, Apple Inc.). Overall morbidity was recorded. Results: Preoperative and follow-up examinations revealed progressive alveolar bone union in all patients. For group 1, final completion of the defect with a 65.0% mean bone height was detected 12 months postoperatively. For group 2, final completion of the defect with an 83.8% mean bone height was detected 6 months postoperatively. Dental eruption routinely occurred in both groups. Clinical complications included significant swelling in three group 1 patients (37.5%) and significant donor-site pain in seven group 2 patients (87.5%). Conclusions: For this select group of patients with immature skeleton, rhBMP-2 therapy resulted in satisfactory bone healing and reduced morbidity compared with traditional iliac crest bone grafting.

PROWESS-SHOCK TRIAL: A PROTOCOL OVERVIEW AND PERSPECTIVES

Sepsis remains a challenge for intensive care physicians, as it keeps up with high mortality rate in spite of the high costs associated with its treatment. Several studies indicate that the infusion of Drotrecogin-alpha activated (DrotAA) reduce mortality in patients at high risk of death when administered early and secured the appropriate initial treatment of sepsis as recommended by Surviving Sepsis Campaign. Europe and United States of America differ regarding the criteria of high risk of death in sepsis, two or more organ dysfunctions and Acute Physiology and Chronic Health Evaluation 25 or more, respectively. In addition to varied definitions of high risk of death for inclusion of patients in sepsis studies, the possibility of bleeding related to drug use and intrinsic limitations related to study design led the Company to develop a new randomized, multinational, placebo-controlled, double-blind study to assess the effectiveness of drug in patients with septic shock in adults.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Pentoxifylline modifies three-dimensional collagen lattice model contraction and expression of collagen types I and III by human fibroblasts derived from post-burn hypertrophic scars and from normal skin

Fibroblasts are thought to be partially responsible for the persisting contractile forces that result in burn contractures. Using a monolayer cell culture and fibroblast populated collagen lattice (FPCL) three-dimensional model we subjected hypertrophic scar and non-cicatricial fibroblasts to the antifibrogenic agent pentoxifylline (PTF - 1 mg/mL) in order to reduce proliferation, collagen types I and III synthesis and model contraction. Fibroblasts were isolated from post-burn hypertrophic scars (HSHF) and non-scarred skin (NHF). Cells were grown in monolayers or incorporated into FPCL`s and exposed to PTF. In monolayer, cell number proliferation was reduced (46.35% in HSHF group and 37.73% in NHF group, p < 0.0001). PTF selectively inhibited collagen III synthesis in the HSHF group while inhibition was more evident to type I collagen synthesis in the NHF group. PTF also reduced contraction in both (HSHF and NHF) FPCL. (C) 2009 Elsevier Ltd and ISBI. All rights reserved.

Exhaled nitric oxide as a predictor of exacerbation in children with moderate-to-severe asthma: a prospective, 5-month study

Background: Inhaled corticosteroids (ICSs) are recommended as the first line of treatment in children with moderate-to-severe asthma. Exhaled nitric oxide (ENO) has been proposed as a clinically useful marker of control that might help identify patients in whom ICS dose may be safely reduced. Objective: To evaluate the ability of ENO to predict future asthma exacerbations in children with moderate-to-severe asthma undergoing ICS tapering. Methods: This is an observational study with no control group. ENO was measured biweekly for 14 weeks in 32 children with moderate-to-severe asthma who were undergoing ICS tapering. Clinical evaluations and spirometry were performed concomitantly, and families kept daily diaries to record symptoms between visits. We used generalized estimating equations to model the In (odds) of an asthma exacerbation in the subsequent 2-week interval as a function of ENO level at the start of the interval while adjusting for age, sex, asthma severity, and current medication use. Results: We were able to successfully lower ICS doses in 10 (56%) of the 18 children with moderate asthma and in 3 (21%) of the 14 children with severe asthma. In 83 of the 187 follow-up clinical evaluations, children were determined to have had an exacerbation during the preceding 2 weeks. ENO levels, whether expressed as a continuous variable or dichotomized, were not associated with future risk for exacerbations in either unadjusted or adjusted models. Conclusion: ENO was not a useful clinical predictor of future asthma exacerbations for children with moderate-to-severe asthma undergoing ICS tapering. Ann Allergy Asthma Immunol. 2009; 103:206-211.

Biologically active conformer of the effector region of human C5a and modulatory effects of N-terminal receptor binding determinants on activity

A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.

Serum from children with polyarticular juvenile idiopathic arthritis (pJIA) inhibits differentiation, mineralization and may increase apoptosis of human osteoblasts ""in vitro""

We examined the effects of polyarticular juvenile idiopathic arthritis (pJIA) serum on proliferation, differentiation, mineralization, and apoptosis of human osteoblast cells (hOb) in culture. The hOb were cultured with 10% serum from active pJIA and healthy controls (CT) and were tested for DNA synthesis, alkaline phosphatase (AP) activity, osteocalcin (OC) secretion, calcium levels, caspase 3 activity, and DNA fragmentation. None of the patients had used glucocorticoids for at least 1 month before the study, or any other drug that can affect bone mineral metabolism. Human inflammatory cytokine levels (IL-6, IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70) were measured in pJIA and CT sera. Low levels of AP activity was observed in pJIA cultures compared with CT cultures (67.16 +/- 53.35 vs 100.11 +/- 50.64 mu mol p-nitrophenol/h(-1) mg(-1) protein, P=0.008). There was also a significant decrease in OC secretion (9.23 +/- 5.63 vs 12.82 +/- 7.02 ng/mg protein, P=0.012) and calcium levels (0.475 +/- 0.197 vs 0.717 +/- 0.366 mmol/l, P=0.05) in pJIA hOb cultures. No difference was observed in cell proliferation (323.56 +/- 108.23 vs 328.91 +/- 88.03 dpm/mg protein, P=0.788). Osteoblasts cultured with JIA sera showed lower levels of DNA and increased fragmentation than osteoblasts cultured with CT sera. pJIA sera showed higher IL-6 values than CT (21.44 +/- 9.31 vs 3.58 +/- 2.38 pg/ml, P<0.001), but no difference was observed related to IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70 between pJIA and controls. This study suggests that serum from children with pJIA inhibits differentiation, mineralization and may increase apoptosis of hOb cultures, and inflammatory cytokines such as IL-6 might be a mechanism in this find. These results may represent an alternative therapeutic target for prevention and treatment of bone loss in JIA.

Expression of insulin-like growth factor-II and its receptor in pediatric and adult adrenocortical tumors

Background: Adrenocortical tumors are heterogeneous neoplasms with incompletely understood pathogenesis. IGF-II overexpression has been consistently demonstrated in adult adrenocortical carcinomas. Objectives: The objective of the study was to analyze expression of IGF-II and its receptor (IGF-IR) in pediatric and adult adrenocortical tumors and the effects of a selective IGF-IR kinase inhibitor (NVP-AEW541) on adrenocortical tumor cells. Patients: Fifty-seven adrenocortical tumors (37 adenomas and 20 carcinomas) from 23 children and 34 adults were studied. Methods: Gene expression was determined by quantitative real-time PCR. Cell proliferation and apoptosis were analyzed in NCI H295 cells and a new cell line established from a pediatric adrenocortical adenoma. Results: IGF-II transcripts were overexpressed in both pediatric adrenocortical carcinomas and adenomas. Otherwise, IGF-II was mainly overexpressed in adult adrenocortical carcinomas (270.5 +/- 130.2 vs. 16.1 +/- 13.3; P = 0.0001). IGF-IR expression was significantly higher in pediatric adrenocortical carcinomas than adenomas (9.1 +/- 3.1 vs. 2.6 +/- 0.3; P = 0.0001), whereas its expression was similar in adult adrenocortical carcinomas and adenomas. IGF-IR expression was a predictor of metastases in pediatric adrenocortical tumors in univariate analysis (hazard ratio 1.84; 95% confidence interval 1.28 -2.66; P = 0.01). Furthermore, NVP-AEW541 blocked cell proliferation in a dose-and time-dependent manner in both cell lines through a significant increase of apoptosis. Conclusion: IGF-IR overexpression was a biomarker of pediatric adrenocortical carcinomas. Additionally, a selective IGF-IR kinase inhibitor had antitumor effects in adult and pediatric adrenocortical tumor cell lines, suggesting that IGF-IR inhibitors represent a promising therapy for human adrenocortical carcinoma.

Abnormal chronotropic reserve and heart rate recovery in patients with SLE: a case-control study

Abnormal heart-rate (HR) response during or after a graded exercise test has been recognized as a strong and an independent predictor of all-cause mortality in healthy and diseased subjects. The purpose of the present study was to evaluate the HR response during exercise in women with systemic lupus erythematosus (SLE). In this case-control study, 22 women with SLE (age 29.5 perpendicular to 1.1 years) were compared with 20 gender-, BMI-, and age-matched healthy subjects (age 26.5 +/- 1.4 years). A treadmill cardiorespiratory test was performed and HR response during exercise was evaluated by the chronotropic reserve (CR). HR recovery (Delta HRR) was defined as the difference between HR at peak exercise and at both first (Delta HRR1) and second (Delta HRR2) minutes after exercising. SLE patients presented lower peak VO(2) when compared with healthy subjects (27.6 perpendicular to 0.9 vs. 36.7 perpendicular to 1.1 ml/kg/min, p = 0.001, respectively). Additionally, SLE patients demonstrated lower CR (71.8 +/- 2.4 vs. 98.2 +/- 2.6%, p = 0.001), Delta HRR1 (22.1 +/- 2.5 vs. 32.4 +/- 2.2%, p = 0.004) and Delta HRR2 (39.1 +/- 2.9 vs. 50.8 +/- 2.5%, p = 0.001) than their healthy peers. In conclusion, SLE patients presented abnormal HR response to exercise, characterized by chronotropic incompetence and delayed Delta HRR. Lupus (2011) 20, 717-720.

CD4+T cells from HIV-1-infected patients recognize wild-type and mutant human immunodeficiency virus-1 protease epitopes

P>Human immunodeficiency virus (HIV)-1 protease is a known target of CD8+ T cell responses, but it is the only HIV-1 protein in which no fully characterized HIV-1 protease CD4 epitopes have been identified to date. We investigated the recognition of HIV-1 protease by CD4+ T cells from 75 HIV-1-infected, protease inhibitor (PI)-treated patients, using the 5,6-carboxyfluorescein diacetate succinimidyl ester-based proliferation assay. In order to identify putative promiscuous CD4+ T cell epitopes, we used the TEPITOPE algorithm to scan the sequence of the HXB2 HIV-1 protease. Protease regions 4-23, 45-64 and 73-95 were identified; 32 sequence variants of the mentioned regions, encoding frequent PI-induced mutations and polymorphisms, were also tested. On average, each peptide bound to five of 15 tested common human leucocyte antigen D-related (HLA-DR) molecules. More than 80% of the patients displayed CD4+ as well as CD8+ T cell recognition of at least one of the protease peptides. All 35 peptides were recognized. The response was not associated with particular HLA-DR or -DQ alleles. Our results thus indicate that protease is a frequent target of CD4+ along with CD8+ proliferative T cell responses by the majority of HIV-1-infected patients under PI therapy. The frequent finding of matching CD4+ and CD8+ T cell responses to the same peptides may indicate that CD4+ T cells provide cognate T cell help for the maintenance of long-living protease-specific functional CD8+ T cells.

B-1 cells temper endotoxemic inflammatory responses

Sepsis syndrome is caused by inappropriate immune activation due to bacteria and bacterial components released during infection. This syndrome is the leading cause of death in intensive care units. Specialized B-lymphocytes located in the peritoneal and pleural cavities are known as B-1 cells. These cells produce IgM and IL-10, both of which are potent regulators of cell-mediated immunity. It has been suggested that B-1 cells modulate the systemic inflammatory response in sepsis. In this study, we conducted in vitro and in vivo experiments in order to investigate a putative role of B-1 cells in a murine model of LPS-induced sepsis. Macrophages and B-1 cells were studied in monocultures and in co-cultures. The B-1 cells produced the anti-inflammatory cytokine IL-10 in response to LPS. In the B-1 cell-macrophage co-cultures, production of proinflammatory mediators (TNF-alpha, IL-6 and nitrite) was lower than in the macrophage monocultures, whereas that of IL-10 was higher in the co-cultures. Co-culture of B-1 IL-10(-/-) cells and macrophages did not reduce the production of the proinflammatory mediators (TNF-alpha, IL-6 and nitrite). After LPS injection, the mortality rate was higher among Balb/Xid mice, which are B-1 cell deficient, than among wild-type mice (65.0% vs. 0.0%). The Balb/Xid mice also presented a proinflammatory profile of TNF-alpha, IL-6 and nitrite, as well as lower levels of IL-10. In the early phase of LPS stimulation, B-1 cells modulate the macrophage inflammatory response, and the main molecular pathway of that modulation is based on IL-10-mediated intracellular signaling. (C) 2010 Elsevier GmbH. All rights reserved.

Chronic obstructive pulmonary disease in Brazil: mortality and hospitalization trends and rates, 1996-2008

SETTING: Chronic obstructive pulmonary disease (COPD) is the third leading cause of death among adults in Brazil. OBJECTIVE: To evaluate the mortality and hospitalisation trends in Brazil caused by COPD during the period 1996-2008. DESIGN: We used the health official statistics system to obtain data about mortality (1996-2008) and morbidity (1998-2008) due to COPD and all respiratory diseases (tuberculosis: codes A15-16; lung cancer: code C34, and all diseases coded from J40 to 47 in the 10th Revision of the International Classification of Diseases) as the underlying cause, in persons aged 45-74 years. We used the Joinpoint Regression Program log-linear model using Poisson regression that creates a Monte Carlo permutation test to identify points where trend lines change significantly in magnitude/direction to verify peaks and trends. RESULTS: The annual per cent change in age-adjusted death rates due to COPD declined by 2.7% in men (95%CI -3.6 to -1.8) and -2.0% (95%CI -2.9 to -1.0) in women; and due to all respiratory causes it declined by -1.7% (95%CI 2.4 to -1.0) in men and -1.1% (95%CI -1.8 to -0.3) in women. Although hospitalisation rates for COPD are declining, the hospital admission fatality rate increased in both sexes. CONCLUSION: COPD is still a leading cause of mortality in Brazil despite the observed decline in the mortality/hospitalisation rates for both sexes.