1000 resultados para Ferramenta computacional
Resumo:
Resumo O presente artigo objetiva promover uma análise da implantação do PDE-Escola em duas unidades educacionais do município de Limeira-SP, que apresentaram o IDEB/2007 abaixo da média nacional e que foram direcionadas a implantar o Programa a partir de 2009. O PDE-Escola trata-se de um programa do Governo Federal que se proclama capaz de viabilizar a autonomia, a obtenção de melhores resultados educacionais e a modernização da estrutura, organização e gestão escolar a partir da adoção de modelos administrativos gerenciais. A finalidade deste estudo foi constatar se os objetivos delineados por tal Programa, no que tange à garantia da autonomia escolar, ganham concretude na prática. A metodologia utilizada nesta pesquisa qualitativa foi o estudo de casos, concretizado por meio de coleta de dados (entrevistas e questionários semiestruturados, análise documental e revisão bibliográfica). Os resultados obtidos acenaram para a imposição de uma metodologia padronizada e burocrática, pautada em mecanismos de monitoramento, cobrança e controle que dificultaram a conquista gradativa da autonomia das escolas pesquisadas. Palavras-chave: PDE-Escola. Autonomia Escolar. Gestão.
Resumo:
Pós-graduação em Saúde Coletiva - FMB
Resumo:
Pós-graduação em Música - IA
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Pós-graduação em Química - IQ
Resumo:
Pós-graduação em Design - FAAC
Resumo:
Pós-graduação em Música - IA
Resumo:
Developmental Coordination Disorder (DCD), a chronic and usually permanent condition found in children, is characterized by motor impairment that interferes with a child's activities of daily living and with academic achievement. One of the most popular tests for the quantitative diagnosis of DCD is the Movement Assessment Battery for Children (MABC). Based on the Battery's standardized scores, it is possible to identify children with typical development, children at risk of developing DCD, and children with DCD. This article describes a computational system we developed to assist with the analysis of results obtained in the MABC test. The tool was developed for the web environment and its database provides integration of MABC data. Thus, researchers around the world can share data and develop collaborative work in the DCD field. In order to help analysis processes, our system provides services for filtering data to show more specific sets of information and present the results in textual, table, and graphic formats, allowing easier and more comprehensive evaluation of the results.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Pós-graduação em Ciência e Tecnologia de Materiais - FC
Resumo:
Pós-graduação em Química - IQ
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
O presente trabalho de conclusão de curso reporta os resultados obtidos durante o estágio de Iniciação Científica realizado no Núcleo de Biossíntese, Bioensaios e Ecofisiologia de Produtos Naturais do Departamento de Química Orgânica do Instituto de Química da UNESP-Araraquara. Foram realizados ensaios de triagem de substâncias naturais, semissintéticas e sintéticas com atividade inibitória sobre a protease aspártica pepsina e a protease serínica subtilisina. As amostras foram obtidas de extratos vegetais e de fungos endofíticos e foram testadas tanto substâncias puras naturais como diterpenos clerodânicos, cromenos, peptídeos e amidas bem como derivados sintéticos do ácido caféico, ferúlico, alcalóides piridínicos, entre outros resultantes das pesquisas realizadas por pesquisadores do NuBBE. Resultados mostraram que os ensaios de inibição da pepsina e da subtilisina apresentaram seletividade para os diferentes tipos de substâncias testadas. Ainda mais, foi possível observar diferenças nos resultados obtidos com os enantiômeros dos cromanos e dos cromenos. As substâncias que apresentaram maiores porcentagens de inibição foram os cromenos, os derivados do ácido cafeico, do ácido ferúlico e do ácido benzóico, as amidas, bem como os diterpenos clerodânicos. Alguns destes resultados foram publicados em revistas indexadas (Flausino et al., 2009; López et al., 2010; Oliveira et al., 2011) e outros estão sendo preparados para publicação
Resumo:
The Rouanet law is a tax incentive law that allows companies to invest up to 4% of their taxes - based on actual profit - in sponsoring cultural projects previously approved by the Ministry of Culture. By sponsoring these projects, companies can have their name attached to them and, consequently, strengthening their brand and increase its visibility in the market. Whereas this project is aligned to the company vision, its image will be strengthened and the sales will increase. Large companies use the Rouanet Law to sponsor cultural events and have very strong names in the Brazilian market, perhaps worldwide. Examples: Petrobras, Banco do Brasil, Banco Bradesco, BNDES, Usiminas, Vale, among others. The Public Relations professional, who’s responsible for internal and external communication of a company, can use it as a differential of his work, expanding the company's profits with minimum investments, aligning the company's vision to actual practices and using the sponsorship as an agent capable of strengthen its social responsibility and, due to that, to increase the trust of its target audience. This study will address the theoretical and practical aspects of the Rouanet Law and of the public relations professionals, beyond mentioning examples on the subject, with special attention to Petrobras, the largest sponsor of cultural projects in Brazil. The greatest problem of the Rouanet Law is the fact that its sponsored projects are mostly concentrated in the Southeast, specifically in the Rio - São Paulo region. The more popular the Act become, for most places it will spread and Brazil may, after some time, become a world reference in the Cultural point