Characterization of inflammatory responses to eccentric exercise in humans

Eccentric exercise commonly results in muscle damage. The primary sequence of events leading to exercise-induced muscle damage is believed to involve initial mechanical disruption of sarcomeres, followed by impaired excitation-contraction coupling and calcium signaling, and finally, activation of calcium-sensitive degradation pathways. Muscle damage is characterized by ultrastructural changes to muscle architecture, increased muscle proteins and enzymes in the bloodstream, loss of muscular strength and range of motion and muscle soreness. The inflammatory response to exercise-induced muscle damage is characterized by leukocyte infiltration and production of pro-inflammatory cytokines within damaged muscle tissue, systemic release of leukocytes and cytokines, in addition to alterations in leukocyte receptor expression and functional activity. Current evidence suggests that inflammatory responses to muscle damage are dependent on the type of eccentric exercise, previous eccentric loading (repeated bouts), age and gender. Circulating neutrophil counts and systemic cytokine responses are greater after eccentric exercise using a large muscle mass (e.g. downhill running, eccentric cycling) than after other types of eccentric exercise involving a smaller muscle mass. After an initial bout of eccentric exercise, circulating leukocyte counts and cell surface receptor expression are attenuated. Leukocyte and cytokine responses to eccentric exercise are impaired in elderly individuals, while cellular infiltration into skeletal muscle is greater in human females than males after eccentric exercise. Whether alterations in intracellular calcium homeostasis influence inflammatory responses to muscle damage is uncertain. Furthermore, the effects of antioxidant supplements are variable, and the limited data available indicates that anti-inflammatory drugs largely have no influence on inflammatory responses to eccentric exercise. In this review, we compare local versus systemic inflammatory responses, and discuss some of the possible mechanisms regulating the inflammatory responses to exercise-induced muscle damage in humans.

Juvenile dermatomyositis and toxoplasmosis: a rare association

Dermatomyositis is an unknown cause`s disease that in general is characterized by muscular inflammation with weakness and typical skin rash (heliotrope and Gottron`s papules). In this article we describe a 13-year-old girl with juvenile dermatomyositis associated with toxoplasmosis. Myositis was treated with corticosteroids and immunosuppressive drugs, but she had good response only after anti-parasitary drug was started.-

DISCORDANCE FOR RETINITIS PIGMENTOSA IN TWO MONOZYGOTIC TWIN PAIRS

Background: Retinitis pigmentosa (RP) is a group of genetically heterogeneous diseases with progressive degeneration of the retina. The condition can be inherited as an autosomal dominant, autosomal recessive, and X-linked trait. Methods: We report on two female twin pairs. One twin of each pair is affected with RP, the other twin is unaffected, both clinically and functionally. Molecular analysis in both twins included zygosity determination, arrayed primer extension chip analysis for autosomal recessive and dominant RP, sequencing of the entire RPGR gene, and analysis of X-chromosome inactivation status. Results: Both unrelated twin pairs were genetically identical. Of the potential pathogenetic mechanisms, skewed X-inactivation was excluded on leukocytes. Autosomal recessive RP and autosomal dominant RP arrayed primer extension chip analysis result was completely normal, excluding known mutations in known genes as the cause of disease in the affected twins. Sequencing excluded mutations in RPGR. A postzygotic recessive or dominant genetic mutation of an RP gene is not impossible. A postfertilization error as a potential cause of uniparental isodisomy is unlikely albeit not entirely impossible. Conclusion: The authors report on the second and third unrelated identical twin pair discordant for RP. The exact cause of the condition and the explanation of the clinical discordance remain elusive. RETINA 31:1164-1169, 2011

Repetitive Transcranial Magnetic Stimulation Is Efficacious as an Add-On to Pharmacological Therapy in Complex Regional Pain Syndrome (CRPS) Type I

Single session repetitive transcranial magnetic stimulation (rTMS) of the motor cortex (M1) is effective in the treatment of chronic pain patients but the analgesic effect of repeated sessions is still unknown We evaluated the effects of rTMS in patients with refractory pain due to complex regional pain syndrome (CRPS) type I Twenty three patients presenting CRPS type I of 1 upper limb were treated with the best medical treatment (analgesics and adjuvant medications physical therapy) plus 10 daily sessions of either real (r) or sham (s) 10Hz rTMS to the motor cortex (M1) Patients were assessed daily and after 1 week and 3 months after the last session using the Visual Analogical Scale (VAS) the McGill Pain Questionnaire (MPQ) the Health Survey 36 (SF 36) and the Hamilton Depression (HDRS) During treatment there was a significant reduction in the VAS scores favoring the r rTMS group mean reduction of 4 65 cm (50 9%) against 2 18 cm (24 7%) in the s rTMS group The highest reduction occurred at the tenth session and correlated to improvement in the affective and emotional subscores of the MPQ and SF 36 Real rTMS to the M1 produced analgesic effects and positive changes in affective aspects of pain in CRPS patients during the period of stimulation Perspective This study shows an efficacy of repetitive sessions of high frequency rTMS as an add on therapy to refractory CAPS type I patients It had a positive effect in different aspects of pain (sensory discriminative and emotional affective) It opens the perspective for the clinical use of this technique (C) 2010 by the American Pain Society

Adenotonsillectomy improves the strength of respiratory muscles in children with upper airway obstruction

Objective: The aim of this paper is to study the respiratory muscle strength by evaluating the maximal inspiratory pressure (MIP), maximal expiratory pressure (MEP) and lung volume before and 3 and 6 months after adenotonsillectomy. This is an interventional, before and after trial. It was set at the Department of Otolaryngology. University of Sao Paulo, School of Medicine. We included 29 children (6-13 years old), both genders, consecutively recruited from the waiting list for adenotonsillectomy. Children were submitted to maximal inspiratory pressures (MIP), maximal expiratory pressure (MEP) evaluation using an analog manovacuometer, lung volume, using incentive expirotometer and thoracic and abdominal perimeter using a centimeter tape. Children were evaluated in 3 different moments: 1 week before and 3 and 6 months after surgery. Results: MIP improved significantly 3 months (p < 0.001) after adenotonsillectomy and MEP did not change (p = 1). There were increases in lung volume (p = 000), chest (p = 0.017) and abdominal perimeter (p = 0.05). Six months after surgery, all parameters improved. MIP (p = 0), MEP (p = 0), lung volume (p = 0.02), chest (p = 0.034) and abdominal perimeter (p = 0.23). Conclusion: This study suggests that there was an improvement in respiratory muscular strength, once there was a significant improvement in maximal inspiratory pressure, lung volume and other parameters after adenotonsillectomy. (C) 2010 Elsevier Ireland Ltd. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Myotomy of the Levator Labii Superioris Muscle and Lip Repositioning: A Combined Approach for the Correction of Gummy Smile

Background: Treatment of excessive gingival display usually involves procedures such as Le Fort impaction or maxillary gingivectomies. The authors propose an alternative technique that reduces the muscular function of the elevator of the upper lip muscle and repositioning of the upper lip. Methods: Fourteen female patients with excessive gingival exposure were operated on between February of 2008 and March of 2009. They were filmed before and at least 6 months after the procedure. They were asked to perform their fullest smile, and the maximum gingival exposures were measured and analyzed using ImageJ software. Patients were operated on under local anesthesia. Their gingival mucosa was freed from the maxilla using a periosteum elevator. Skin and subcutaneous tissue were dissected bluntly from the underlying musculature of the upper lip. A frenuloplasty was performed to lengthen the upper lip. Both levator labii superioris muscles were dissected and divided. Results: The postoperative course was uneventful in all of the patients. The mean gingival exposure before surgery was 5.22 +/- 1.48 mm; 6 months after surgery, it was 1.91 +/- 1.50 mm. The mean gingival exposure reduction was 3.31 +/- 1.05 mm (p < 0.001), ranging from 1.59 to 4.83 mm. Conclusion: This study shows that the proposed technique was efficient in reducing the amount of exposed gum during smile in all patients in this series. (Plast. Reconstr. Surg. 126: 1014, 2010.)

The possible role of physical exercise on the treatment of idiopathic inflammatory myopathies

Idiopathic inflammatory myopathies (IIM) are a heterogeneous group of diseases that share some symptoms such as muscular weakness and inflammation of skeletal muscle. Complete recovery of muscle function with pharmacological treatment does not always occur, suggesting that physical inability is a great concern for these patients. In this context, it has been speculated that physical exercise could result in functional benefits to patients with IIM, leading to an improvement in quality of life. In fact, recent studies of polymyositis (PM) and dermatomyositis (DM) support the notion that exercise training improves or at least stabilizes muscle strength and functional ability without inducing disease flares. Importantly, these benefits were observed not only during the chronic phase, but also in the course of active disease. This positive effect was found to be long term, as demonstrated by a six-month significant improvement in exercise capacity and strength. Together, these findings indicate that a well controlled exercise program can be recommended for patients with DM and PM. The optimal exercise modality training and the underlying mechanism for this encouraging response remain to be determined in future studies. (C) 2008 Elsevier B.V. All rights reserved.

Postlepidapedon Zdzitowiecki, 1993 and Gibsonivermis n g (Digenea: Lepocreadiidae) from fishes of the southern Great Barrier Reef, Australia, and their relationship to Intusatrium Durio & Manter, 1968

The genus Intusatrium Durio & Manter, 1968 is redefined based on a re-examination of paratypes of the type-species, I. robustum Durio & Manter, 1968, and is considered monotypic with characteristic terminal genitalia: internal seminal vesicle elongate tubular, with rather thick wall, divided by slight change in wall thickness into longer proximal and shorter distal region; pars prostatica subcylindrical; ejaculatory duct relatively short, with wrinkled/wall. The genus Postlepidapedon Zdzitowiecki, 1993 is redefined and Intusatrium secundum Durio & Manter, 1968 is attributed to it as a new combination. Postlepidapedon secundum n. comb. is redescribed from a paratype and new material from Choerodon graphicus. P. spissum n. sp. from Choerodon venustus, C. cyanodus, C. fasciatus and C. schoenleinii is recognised on the basis of its thick-walled internal seminal vesicle. I! uberis n. sp. from Choerodon schoenleinii and C. venustus is distinguished by the shape and contents of the cirrus-sac with narrow, convoluted internal seminal vesicle, large vesicular pars prostatica and short, muscular ejaculatory duct. A new genus, Gibsonivermis, erected for Intusatrium berryi Gibson, 1987, is characterised by the elongate narrow cirrus-sac and a uroproct. G. berryi n. comb. is redescribed from Sillago ciliata, S. maculata and Sillago sp.

Beneficial Effect of Creatine Supplementation in Knee Osteoarthritis

NEVES JR., M., B. GUALANO, H. ROSCHEL, R. FULLER, F. B. BENATTI, A. L. DE SA PINTO, F. R. LIMA, R. M. PEREIRA, A. H. LANCHA JR., E. BONFA. Beneficial Effect of Creatine Supplementation in Knee Osteoarthritis. Med. Sci. Sports Exerc., Vol. 43, No. 8, pp. 1538-1543, 2011. Introduction: The aim of this study was to investigate the efficacy of creatine (CR) supplementation combined with strengthening exercises in knee osteoarthritis (OA). Methods: A randomized, double-blind, placebo-controlled trial was performed. Postmenopausal women with knee OA were allocated to receive either CR (20 g.d(-1) for 1 wk and 5 g.d(-1) thereafter) or placebo (PL) and were enrolled in a lower limb resistance training program. They were assessed at baseline (PRE) and after 12 wk (POST). The primary outcome was the physical function as measured by the timed-stands test. Secondary outcomes included lean mass, quality of life, pain, stiffness, and muscle strength. Results: Physical function was significantly improved only in the CR group (P = 0.006). In addition, a significant between-group difference was observed (CR: PRE = 15.7 +/- 1.4, POST = 18.1 +/- 1.8; PL: PRE = 15.0 +/- 1.8, POST = 15.2 +/- 1.2; P = 0.004). The CR group also presented improvements in physical function and stiffness subscales as evaluated by the Western Ontario and McMaster Universities Osteoarthritis Index (P = 0.005 and P = 0.024, respectively), whereas the PL group did not show any significant changes in these parameters (P > 0.05). In addition, only the CR group presented a significant improvement in lower limb lean mass (P = 0.04) as well as in quality of life (P = 0.01). Both CR and PL groups demonstrated significant reductions in pain (P G 0.05). Similarly, a main effect for time revealed an increase in leg-press one-repetition maximum (P = 0.005) with no significant differences between groups (P = 0.81). Conclusions: CR supplementation improves physical function, lower limb lean mass, and quality of life in postmenopausal women with knee OA undergoing strengthening exercises.

Physical function interfering with pain and symptoms in fibromyalgia patients

Objectives. The aim of this study was to assess the relationship between variables of physical assessment - muscular strength, flexibility and dynamic balance - with pain, pain threshold, and fibromyalgia symptoms (FM). Methods. Our sample consists of 55 women, with age ranging from 30 to 55 years (mean of 46.5, (standard deviation, SD=6.6)), mean body mass index (BMI) of 28.7(3.8) and diagnosed for FM according to the American College of Rheumatology criteria. Pain intensity was measured using a visual analogue scale (VAS) and pain threshold (PT) using Fisher`s dolorimeter. FM symptoms were assessed by the Fibromyalgia Impact Questionnaire (FIQ); flexibility by the third finger to floor test (3FF); the muscular strength index (MSI) by the maximum volunteer isometric contraction at flexion and extension of right knee and elbow using a force transducer, dynamic balance by the time to get up and go (TUG) test and the functional reach test (FRT). Data were analysed using Pearson`s correlation, as well as simple and multivariate regression tests, with significance level of 5%. Results. PT and FIQ were weakly but significantly correlated with the TUG, MSI and 3FF as well as VAS with the TUG and MSI (p<0.05). VAS, PT and FIQ was not correlated with FRT. Simple regression suggests that, alone, TUG, FR, MSI and 3FF are low predictors of VAS, PT and FIQ. For the VAS, the best predictive model includes TUG and MSI, explaining 12.6% of pain. variability. For TP and total symptoms, as obtained by the FIQ, most predictive model includes 3FF and MSI, which respectively respond by 30% and 21% of the variability. Conclusion. Muscular strength, flexibility and balance are associated with pain, pain threshold, and symptoms in FM patients.

Endoscopic treatment of Zenker`s diyerticulum by harmonic scalpel

Background: Zenker`s diverticulum (ZD) is a rare condition with a reported prevalence of 0.01% to 0.11% in the general population. Endoscopic treatment consists of the division of the septum between the diverticulum and the esophagus, within which the cricopharyngeal muscle is contained. Diathermic monopolar current, argon plasma coagulation, and laser have been used to incise the muscular septum with satisfactory results. The main limitation of endoscopic treatment is the occurrence of complications. Perforation and hemorrhage are reported in as many as 23% and 10% of patients, respectively. Objective: The aim of this study was to use the technique of endoscopic diverticulotomy by using a harmonic scalpel in patients with ZD and to demonstrate the feasibility of using flexible and rigid devices in ZD treatment. Design: Case series study. Standard protocol was used for patient management, endoscopic procedure, and data collection. Setting: Single endoscopist demonstrating preliminary results. Patients: Five patients (4 men; median standard deviation [SD] age 69.6 +/- 9.06 years, range 59-83 years) with ZD were treated with this technique. All patients reported dysphagia and halitosis. The diagnosis was based on clinical, endoscopic, and radiographic findings. Interventions: All patients received general anesthesia and were placed in the left lateral position. A standard videogastroscope (9.8 mm) and a stiff guidewire were used to insert and achieve an adequate exposure of the ZD septum. The septum was divided using a harmonic scalpel under thin endoscope (5.2 mm) visualization through a soft diverticuloscope. Main Outcome Measurement: Feasibility of an endoscopic technique by using rigid and flexible devices to treat ZD. Results: Four patients (80%) were successfully treated in 1 session. The median SD size of the diverticulum was 3.6 +/- 0.89 cm (range 3-5 cm). Median SD procedure time was 17.33 +/- 2.33 minutes (range 15-20 minutes) in 6 procedures. No hemorrhage or perforation occurred. One patient (20%) required a second session to complete dissection of the ZD septum. All patients demonstrated improvement of dysphagia score after treatment. Limitations: Small case series design. Conclusions: Endoscopic treatment of ZD by harmonic scalpel through a soft diverticuloscope was feasible and effective in this small case series. Larger studies are warranted to further evaluate this technique.

Metallic Voice: Physiological and Acoustic Features

The metallic voice is usually confused with ring or nasality by singers and nontrained listeners. who are not used to perceptual vocal analysis. They believe a metallic voice results from a rise in fundamental frequency. A diagnostic error in this aspect may lead to lowering pitch, an incorrect procedure that Could Cause vocal overload and fatigue. The purpose of this article is to Study the quality of metallic voice considering the correlation between information of the physiological and acoustic plans, based on a perceptive consensual assumption. Fiberscopic video pharyngolaryngoscopy was performed on 21 professional singers while speaking vowel [e]-in normal and metallic modes to observe muscular movements and structural changes of the velopharynx, pharynx, and larynx. Vocal samples captured simultaneously to the fiberscopic examination were acoustically analyzed. Frequency and amplitude of the first four formants (F(1), F(2), F(3), and F(4)) were extracted by means of linear predictor coefficients (LPC) Spectrum and were statistically analyzed. Vocal tract adjustments such as velar lowering, pharyngeal wall narrowing, laryngeal rise, aryepiglottic, and lateral laryngeal constrictions were frequently found: there were no significant changes in frequency and amplitude of F(1) in the metallic voiced there were significant increases in amplitudes of F(2), F(3), and F(4) and in frequency for F, metallic Voice perceived as louder was correlated to an increase ill amplitude of F(3) and F(4). Physiological adjustments of velopharynx, pharynx, and larynx are combined in characterizing the metallic voice and can be acoustically related to changes in formant pattern.

Endometriosis lesions that compromise the rectum deeper than the inner muscularis layer have more than 40% of the circumference of the rectum affected by the disease

Study Objective: To estimate the relationship between the depth of lesions of rectal endometriosis and the percentage of the circumference of the bowel segment affected by the disease. Design: A prospective pathologic analysis of 45 surgical specimens of bowel endometriosis obtained by laparoscopic segmental resection of the rectosigmoid (Canadian Task Force classification II-1). Setting: Tertiary referral hospital. Patients: forty-five patients were submitted to a segmental resection of the rectum due to endometriosis between July 2004 and September 2006. Interventions: Morphometric aspects of endometriotic lesions were analyzed, such as size and thickness of the lesion, deepest layer of bowel affected by lesion, and percentage of circumference of bowel affected by endometriosis. Measurements and Main Results: Results showed that in lesions that reached the submucous layer of the bowel, the circumference affected was 31.6% greater than in lesions that reached only the outer muscular layer, whereas in lesions that reached the mucous layer, the circumference affected was 52.5% greater than in those that reached the outer muscular layer of the bowel. In addition, 89.3% of lesions with an affected circumference greater than 40% were those affecting the submucous or mucous layers of the bowel. These results suggest that when a lesion reaches these 2 deepest layers of the rectosiamoid, risk increases that the circumference affected will be greater than 40% (relative risk = 1.5; 95% CI: 1.0-2.3; p =.03). Conclusion: In endometriotic lesions affecting the rectosigmoid beyond the inner muscular layer of the bowel wall, more than 40% of the circumference of the rectosigmoid is affected by the disease, confirming the recommendation of segmental resection of the bowel for this form of the disease.

Understanding systemic lupus erythematosus physiopathology in the light of primary immunodeficiencies

Introduction Associations between systemic lupus erythematosus (SLE) and primary immunodeficiencies (PIDs) were analyzed to gain insight into the physiopathology of SLE. Some PIDs have been consistently associated with SLE or lupus-like manifestations: (a) homozygous deficiencies of the early components of the classical complement pathway in the following decreasing order: in C1q, 93% of affected patients developed SLE; in C4, 75%; in C1r/s, 57%; and in C2, up to 25%; (b) female carriers of X-linked chronic granulomatous disease allele; and (c) IgA deficiency, present in around 5% of juvenile SLE. Discussion In the first two groups, disturbances of cellular waste-disposal have been proposed as the main mechanisms of pathogenesis. On the other hand and very interestingly, there are PIDs systematically associated with several autoimmune manifestations in which SLE has not been described, such as autoimmune polyendocrinopathy candidiasis ectodermal dystrophy (APECED), immunedys-regulation polyendocrinopathy enteropathy X-linked (IPEX), and autoinumme lymphoproliferative syndrome (ALPS), suggesting that mechanisms considered as critical players for induction and maintenance of tolerance to autoantigens, such as (1) AME-mediated thymic negative selection of lymphocytes, (2) Foxp3+ regulatory T cell-mediated peripheral tolerance, and (3) deletion of auto-reactive lymphocytes by Fas-mediated apoptosis, could not be relevant in SLE physiopathology. The non-description of SLE and neither the most characteristic SLE clinical features among patients with agammaglobulinemia are also interesting observations, which reinforce the essential role of B lymphocytes and antibodies for SLE pathogenesis. Conclusion Therefore, monogenic PIDs represent unique and not fully explored human models for unraveling components of the conundrum represented by the physiopathology of SLE, a prototypical polygenic disease.