The Bacillus subtilis bacteriophage SPP1 G39P delivers and activates the G40P DNA helicase upon interacting with the G38P-bound replication origin.

Initiation of Bacillus subtilis bacteriophage SPP1 replication requires the phage-encoded genes 38, 39 and 40 products (G38P, G39P and G40P). G39P, which does not bind DNA, interacts with the replisome organiser, G38P, in the absence of ATP and with the ATP-activated hexameric replication fork helicase, G40P. G38P, which specifically interacts with the phage replication origin (oriL) DNA, does not seem to form a stable complex with G40P in solution. G39P when complexed with G40P-ATP inactivates the single-stranded DNA binding, ATPase and unwinding activities of G40P, and such effects are reversed by increasing amounts of G38P. Unwinding of a forked substrate by G40P-ATP is increased about tenfold by the addition of G38P and G39P to the reaction mixture. The specific protein-protein interactions between oriL-bound G38P and the G39P-G40P-ATPgammaS complex are necessary for helicase delivery to the SPP1 replication origin. Formation of G38P-G39P heterodimers releases G40P-ATPgammaS from the unstable oriL-G38P-G39P-G40P-ATPgammaS intermediate. G40P-ATPgammaS binds to the origin region, the uncomplexed G38P fraction remains bound to oriL, and the G38P-G39P heterodimer is lost from the complex. We demonstrate that G39P is a component of an oligomeric nucleoprotein complex which plays an important role in the initiation of SPP1 replication.

Phylogeography and Pleistocene refugia of the adder (Vipera berus) as inferred from mitochondrial DNA sequence data.

In order to contribute to the debate about southern glacial refugia used by temperate species and more northern refugia used by boreal or cold-temperate species, we examined the phylogeography of a widespread snake species (Vipera berus) inhabiting Europe up to the Arctic Circle. The analysis of the mitochondrial DNA (mtDNA) sequence variation in 1043 bp of the cytochrome b gene and in 918 bp of the noncoding control region was performed with phylogenetic approaches. Our results suggest that both the duplicated control region and cytochrome b evolve at a similar rate in this species. Phylogenetic analysis showed that V. berus is divided into three major mitochondrial lineages, probably resulting from an Italian, a Balkan and a Northern (from France to Russia) refugial area in Eastern Europe, near the Carpathian Mountains. In addition, the Northern clade presents an important substructure, suggesting two sequential colonization events in Europe. First, the continent was colonized from the three main refugial areas mentioned above during the Lower-Mid Pleistocene. Second, recolonization of most of Europe most likely originated from several refugia located outside of the Mediterranean peninsulas (Carpathian region, east of the Carpathians, France and possibly Hungary) during the Mid-Late Pleistocene, while populations within the Italian and Balkan Peninsulas fluctuated only slightly in distribution range, with larger lowland populations during glacial times and with refugial mountain populations during interglacials, as in the present time. The phylogeographical structure revealed in our study suggests complex recolonization dynamics of the European continent by V. berus, characterized by latitudinal as well as altitudinal range shifts, driven by both climatic changes and competition with related species.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Characterization of cytoplasmic antiviral signaling pathways

Summary Multicellular organisms have evolved the immune system to protect from pathogen such as viruses, bacteria, fungi or parasites. Detection of invading pathogens by the host innate immune system is crucial for mounting protective responses and depends on the recognition of microbial components by specific receptors. The results presented in this manuscript focus on the signaling pathways involved in the detection of viral infection by the sensing of viral nucleic acids. First, we describe a new regulatory mechanism controlling RNA-sensing antiviral pathways. Our results indicate that TRIF and Cardif, the crucial adaptor proteins for endosomal and cytoplasmic RNA detection signaling pathway, are processed and inactivated by caspases. The second aspect investigated here involves a signaling pathway triggered upon cytosolic DNA sensing. The interferon inducible protein DAI was recently described as a DNA sensor able to induce the activation of IRFs and NF-κΒ transcription factors leading to type I interferon production. Here we identify two RIP homotypic interaction motifs (RHIMs) in DAI and demonstrate that they mediate the recruitment of RIP1 and RIP3 and the subsequent NF-κΒ activation. Moreover, we observed that the mouse cytomegalovirus RHIM- containing protein M45 has the potential to block this signaling cascade by interfering with the formation of the DAI-RIP1/3 signaling complex. Finally, we report the generation and the initial characterization of NLRX1-deficient mice. NLRX1 is a member of the NOD-like receptor family localized to the mitochondria. The function of NLRX1 is still controversial: one study proposed that NLRX1 acts as an inhibitor of the RIG-like receptor (RLR) antiviral pathway by binding the adaptor protein Cardif, whereas another report implicated NLRX1 in the generation of reactive oxygen species (ROS) and the amplification of NF-κΒ and JNK triggered by TNF-α, poly(I:C) or Shigella infection. Collectively, our results indicate that NLRX1-deficiency does not affect RLR signaling nor TNF-α induced responses. Proteomics analysis identified UQCRC2, a subunit of the complex III of the mitochondrial respiratory chain, as a NLRX1 binding partner. This observation might reveal a possible functional link between NLRX1 and mitochondrial respiration and/or ROS generation. Résumé Au cours de l'évolution, les organismes multicellulaires ont développé le système immunitaire afin de se protéger contre les pathogènes. Une étape cruciale pour le déclenchement des réponses protectrices est la reconnaissance par les cellules du système immunitaire de molécules propres aux microbes grâce à des récepteurs spécifiques. Les résultats présentés dans cette thèse décrivent des nouveaux aspects concernant les voies de signalisation impliquées dans la détection des virus. Le premier projet décrit un mécanisme de régulation des voies activées par la détection d'ARN virale. Nos résultats montrent que TRIF et Cardif, des protéines adaptatrices des voies déclenchées par la reconnaissance de ces acides nucléiques au niveau des endosomes et du cytoplasme, sont clivés et inactivés par les caspases. Le projet suivant de notre recherche concerne une voie de signalisation activée par la détection d'ADN au niveau du cytoplasme. La protéine DAI a été récemment décrite comme un senseur pour cet ADN capable d'activer les facteurs de transcription IRF et NF-κΒ et d'induire ainsi la production des interférons de type I. Ici on démontre que DAI interagit avec RIP1 et RIP3 par le biais de domaines appelés RHIM et que ce complexe est responsable de l'activation de NF-κΒ. On a aussi identifié une protéine du cytomégalovirus de la souris, M45, qui contient ce même domaine et on a pu démontrer qu'elle a la capacité d'interférer avec la formation du complexe entre DAI et RIP1/RIP3 bloquant ainsi l'activation de NF-κΒ. Enfin on décrit ici la génération de souris déficientes pour le gène qui code pour la protéine NLRX1. Cette protéine fait partie de la famille des récepteurs NOD et est localisée dans la mitochondrie. Une étude a suggéré que NLRX1 agit comme un inhibiteur des voies antivirales activées par les récepteurs du type RIG-I (RLR) en interagissant avec la protéine adaptatrice Cardif. Une autre étude propose par contre que NLRX1 participe à la production des dérivés réactifs de l'oxygène et contribue ainsi à augmenter l'activation de NF- κΒ et JNK induite par le TNF-α ou le poly(I:C). Nos résultats montrent que l'absence de NLRX1 ne modifie ni la voie de signalisation RLR ni les réponses induites par le TNF-α. Des analyses ultérieures ont permis d'identifier comme partenaire d'interaction de NLRX1 la protéine UQCRC2, une des sous-unités qui composent le complexe III de la chaîne respiratoire mitochondriale. Cette observation pourrait indiquer un lien fonctionnel entre NLRX1 et la respiration mitochondriale ou la production des dérivés réactifs de l'oxygène au niveau de cette organelle.

DNA ja koulukirjat vielä kerran

Kirjoitus on lisäys professorien Olli Halkan ja Veikko Sorsan artikkeleihin TT -lehdessä 2 ja 3/2004.

Siihen aikaan kun DNA lukion biologian kirjoihin tuli

Vastine Olli Halkan kirjoitukseen TT -lehdessä 2/2004

MHC class II hierarchy of superantigen presentation predicts efficiency of infection with mouse mammary tumor virus.

Superantigens (SAgs) encoded by infectious mouse mammary tumor viruses (MMTVs) play a crucial role in the viral life cycle. Their expression by infected B cells induces a proliferative immune response by SAg-reactive T cells which amplifies MMTV infection. This response most likely ensures stable MMTV infection and transmission to the mammary gland. Since T cell reactivity to SAgs from endogenous Mtv loci depends on MHC class II molecules expressed by B cells, we have determined the ability of MMTV to infect various MHC congenic mice. We show that MHC class II I-E+ compared with I-E- mouse strains show higher levels of MMTV infection, most likely due to their ability to induce a vigorous SAg-dependent immune response following MMTV encounter. Inefficient infection is observed in MHC class II I-E- mice, which have been shown to present endogenous SAgs poorly. Therefore, during MMTV infection the differential ability of MHC class II molecules to form a functional complex with SAg determines the magnitude of the proliferative response of SAg-reactive T cells. This in turn influences the degree of T cell help provided to infected B cells and therefore the efficiency of amplification of MMTV infection.

DNA ja Helsingin geneetikot

Vastine TT -lehden numerossa 8/2003 olleeseen Jani Rydmanin kommenttiin Pekkan Nuortevan Luonnon tutkijassa olleeseen artikkeliin

Validation of real-time methylation-specific PCR to determine O6-methylguanine-DNA methyltransferase gene promoter methylation in glioma.

Epigenetic silencing of the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) by promoter methylation predicts successful alkylating agent therapy, such as with temozolomide, in glioblastoma patients. Stratified therapy assignment of patients in prospective clinical trials according to tumor MGMT status requires a standardized diagnostic test, suitable for high-throughput analysis of small amounts of formalin-fixed, paraffin-embedded tumor tissue. A direct, real-time methylation-specific PCR (MSP) assay was developed to determine methylation status of the MGMT gene promoter. Assay specificity was obtained by selective amplification of methylated DNA sequences of sodium bisulfite-modified DNA. The copy number of the methylated MGMT promoter, normalized to the beta-actin gene, provides a quantitative test result. We analyzed 134 clinical glioma samples, comparing the new test with the previously validated nested gel-based MSP assay, which yields a binary readout. A cut-off value for the MGMT methylation status was suggested by fitting a bimodal normal mixture model to the real-time results, supporting the hypothesis that there are two distinct populations within the test samples. Comparison of the tests showed high concordance of the results (82/91 [90%]; Cohen's kappa = 0.80; 95% confidence interval, 0.82-0.95). The direct, real-time MSP assay was highly reproducible (Pearson correlation 0.996) and showed valid test results for 93% (125/134) of samples compared with 75% (94/125) for the nested, gel-based MSP assay. This high-throughput test provides an important pharmacogenomic tool for individualized management of alkylating agent chemotherapy.

Current directions in DNA gel particles

A general understanding of interactions between DNA andoppositely charged compounds forms the basis for developing novelDNA-based materials, including gel particles. The association strength,which is altered by varying the chemical structure of the cationiccosolute, determines the spatial homogeneity of the gelation process,creating DNA reservoir devices and DNA matrix devices that can bedesigned to release either single- (ssDNA) or double-stranded(dsDNA) DNA. This paper reviews the preparation of DNA gelparticles using surfactants, proteins and polysaccharides. Particlemorphology, swelling/dissolution behaviour, degree of DNAentrapment and DNA release responses as a function of the nature ofthe cationic agent used are discussed. Current directions in thehaemocompatible and cytotoxic characterization of these DNA gelparticles have been also included.

A prospective molecular surveillance study evaluating the clinical impact of community-acquired respiratory viruses in lung transplant recipients.

BACKGROUND: Community-acquired respiratory viral infections (RVIs) are common in lung transplant patients and may be associated with acute rejection and bronchiolitis obliterans syndrome (BOS). The use of sensitive molecular methods that can simultaneously detect a large panel of respiratory viruses may help better define their effects. METHODS: Lung transplant recipients undergoing serial surveillance and diagnostic bronchoalveolar lavages (BALs) during a period of 3 years were enrolled. BAL samples underwent multiplex testing for a panel of 19 respiratory viral types/subtypes using the Luminex xTAG respiratory virus panel assay. RESULTS: Demographics, symptoms, and forced expiratory volume in 1 sec were prospectively collected for 93 lung transplant recipients enrolled. Mean number of BAL samples was 6.2+/-3.1 per patient. A respiratory virus was isolated in 48 of 93 (51.6%) patients on at least one BAL sample. Of 81 positive samples, the viruses isolated included rhinovirus (n=46), parainfluenza 1 to 4 (n=17), coronavirus (n=11), influenza (n=4), metapneumovirus (n=4), and respiratory syncytial virus (n=2). Biopsy-proven acute rejection (> or =grade 2) or decline in forced expiratory volume in 1 sec > or =20% occurred in 16 of 48 (33.3%) patients within 3 months of RVI when compared with 3 of 45 (6.7%) RVI-negative patients within a comparable time frame (P=0.001). No significant difference was seen in incidence of acute rejection between symptomatic and asymptomatic patients. Biopsy-proven obliterative bronchiolitis or BOS was diagnosed in 10 of 16 (62.5%) patients within 1 year of infection. CONCLUSION: Community-acquired RVIs are frequently detected in BAL samples from lung transplant patients. In a significant percentage of patients, symptomatic or asymptomatic viral infection is a trigger for acute rejection and obliterative bronchiolitis/BOS.

Owl pellets as a source of DNA for genetic studies of small mammals.

Owl pellets contain a good skeletal record of the small mammals consumed, and correspond to the undigested portions of prey which are regurgitated. These pellets are easy to find at the roosting site of owls. As it has been demonstrated that amplifiable DNA can be isolated from ancient bone remains, the possibility of using owl pellets as a source of DNA for small mammal genetics studies via the polymerase chain reaction has been investigated. The main uncertainties when isolating DNA from such a material are firstly the possibility that the extracted DNA would be too degraded during the digestion in the stomach of the owl, and secondly that extensive cross-contaminations could occur among the different prey consumed. The results obtained clearly demonstrate that cross-contamination does not occur, and that mitochondrial and nuclear DNA can be amplified using skulls of small mammals found in owl pellets as a source of DNA. The relative efficiency of two methods of DNA extraction is estimated and discussed. Thus, owl pellets represent a non-invasive sampling technique which provides a valuable source of DNA for studying population genetics of small mammals.

Cytosolic sensing of extracellular self-DNA transported into monocytes by the antimicrobial peptide LL37.

The intracellular location of nucleic acid sensors prevents recognition of extracellular self-DNA released by dying cells. However, on forming a complex with the endogenous antimicrobial peptide LL37, extracellular DNA is transported into endosomal compartments of plasmacytoid dendritic cells, leading to activation of Toll-like receptor-9 and induction of type I IFNs. Whether LL37 also transports self-DNA into nonplasmacytoid dendritic cells, leading to type I IFN production via other intracellular DNA receptors is unknown. Here we found that LL37 very efficiently transports self-DNA into monocytes, leading the production of type I IFNs in a Toll-like receptor-independent manner. This type I IFN induction was mediated by double-stranded B form DNA, regardless of its sequence, CpG content, or methylation status, and required signaling through the adaptor protein STING and TBK1 kinase, indicating the involvement of cytosolic DNA sensors. Thus, our study identifies a novel link between the antimicrobial peptides and type I IFN responses involving DNA-dependent activation of cytosolic sensors in monocytes.

A nuclear defect in the 4p16 region predisposes to multiple mitochondrial DNA deletions in families with Wolfram syndrome.

Wolfram syndrome is a progressive neurodegenerative disorder transmitted in an autosomal recessive mode. We report two Wolfram syndrome families harboring multiple deletions of mitochondrial DNA. The deletions reached percentages as high as 85-90% in affected tissues such as the central nervous system of one patient, while in other tissues from the same patient and from other members of the family, the percentages of deleted mitochondrial DNA genomes were only 1-10%. Recently, a Wolfram syndrome gene has been linked to markers on 4p16. In both families linkage between the disease locus and 4p16 markers gave a maximum multipoint lod score of 3.79 at theta = 0 (Pi<0.03) with respect to D4S431. In these families, the syndrome was caused by mutations in this nucleus-encoded gene which deleteriously interacts with the mitochondrial genome. This is the first evidence of the implication of both genomes in a recessive disease.

A nuclear defect in the 4p16 region predisposes to multiple mitochondrial DNA deletions in families with Wolfram syndrome.

Wolfram syndrome is a progressive neurodegenerative disorder transmitted in an autosomal recessive mode. We report two Wolfram syndrome families harboring multiple deletions of mitochondrial DNA. The deletions reached percentages as high as 85-90% in affected tissues such as the central nervous system of one patient, while in other tissues from the same patient and from other members of the family, the percentages of deleted mitochondrial DNA genomes were only 1-10%. Recently, a Wolfram syndrome gene has been linked to markers on 4p16. In both families linkage between the disease locus and 4p16 markers gave a maximum multipoint lod score of 3.79 at theta = 0 (Pi<0.03) with respect to D4S431. In these families, the syndrome was caused by mutations in this nucleus-encoded gene which deleteriously interacts with the mitochondrial genome. This is the first evidence of the implication of both genomes in a recessive disease.