998 resultados para DNA uptake
Biological embedding of early-life exposures and disease risk in humans : a role for DNA methylation
Resumo:
BACKGROUND: Following wider acceptance of 'the thrifty phenotype' hypothesis and the convincing evidence that early-life exposures can influence adult health even decades after the exposure, much interest has been placed on the mechanisms through which early-life exposures become biologically embedded. MATERIALS AND METHODS: In this review, we summarize the current literature regarding biological embedding of early-life experiences. To this end, we conducted a literature search to identify studies investigating early-life exposures in relation to DNA methylation changes. In addition, we summarize the challenges faced in investigations of epigenetic effects, stemming from the peculiarities of this emergent and complex field. A proper systematic review and meta-analyses were not feasible given the nature of the evidence. RESULTS: We identified seven studies on early-life socio-economic circumstances, 10 studies on childhood obesity and six studies on early-life nutrition all relating to DNA methylation changes that met the stipulated inclusion criteria. The pool of evidence gathered, albeit small, favours a role of epigenetics and DNA methylation in biological embedding, but replication of findings, multiple comparison corrections, publication bias and causality are concerns remaining to be addressed in future investigations. CONCLUSIONS: Based on these results, we hypothesize that epigenetics, in particular DNA methylation, is a plausible mechanism through which early-life exposures are biologically embedded. This review describes the current status of the field and acts as a stepping stone for future, better designed investigations on how early-life exposures might become biologically embedded through epigenetic effects.
Resumo:
Introduction: Prior repeated-sprints (6) has become an interesting method to resolve the debate surrounding the principal factors that limits the oxygen uptake (V'O2) kinetics at the onset of exercise [i.e., muscle O2 delivery (5) or metabolic inertia (3)]. The aim of this study was to compare the effects of two repeated-sprints sets of 6x6s separated by different recovery duration between the sprints on V'O2 and muscular de-oxygenation [HHb] kinetics during a subsequent heavy-intensity exercise. Methods: 10 male subjects performed a 6-min constant-load cycling test (T50) at intensity corresponding to half of the difference between V'O2max and the ventilatory threshold. Then, they performed two repeated-sprints sets of 6x6s all-out separated by different recovery duration between the sprints (S1:30s and S2:3min) followed, after 7-min-recovery, by the T50 (S1T50 and S2T50, respectively). V'O2, [HHb] of the vastus lateralis (VL) and surface electromyography activity [i.e., root-mean-square (RMS) and the median frequency of the power density spectrum (MDF)] from VL and vastus medialis (VM) were recorded throughout T50. Models using a bi-exponential function for the overall T50 and a mono-exponential for the first 90s of T50 were used to define V'O2 and [HHb] kinetics respectively. Results: V'O2 mean value was higher in S1 (2.9±0.3l.min-1) than in S2 (1.2±0.3l.min-1); (p<0.001). The peripheral blood flow was increased after sprints as attested by a higher basal heart rate (HRbaseline) (S1T50: +22%; S2T50: +17%; p≤0.008). Time delay [HHb] was shorter for S1T50 and S2T50 than for T50 (-22% for both; p≤0.007) whereas the mean response time of V'O2 was accelerated only after S1 (S1T50: 32.3±2.5s; S2T50: 34.4±2.6s; T50: 35.7±5.4s; p=0.031). There were no significant differences in RMS between the three conditions (p>0.05). MDF of VM was higher during the first 3-min in S1T50 than in T50 (+6%; p≤0.05). Conclusion: The study show that V'O2 kinetics was speeded by prior repeated-sprints with a short (30s) but not a long (3min) inter-sprints-recovery even though the [HHb] kinetics was accelerated and the peripheral blood flow was enhanced after both sprints. S1, inducing a greater PCr depletion (1) and change in the pattern of the fibres recruitment (increase in MDF) compared with S2, may decrease metabolic inertia (2), stimulate the oxidative phosphorylation activation (4) and accelerate V'O2 kinetics at the beginning of the subsequent high-intensity exercise.
Resumo:
Initiation of Bacillus subtilis bacteriophage SPP1 replication requires the phage-encoded genes 38, 39 and 40 products (G38P, G39P and G40P). G39P, which does not bind DNA, interacts with the replisome organiser, G38P, in the absence of ATP and with the ATP-activated hexameric replication fork helicase, G40P. G38P, which specifically interacts with the phage replication origin (oriL) DNA, does not seem to form a stable complex with G40P in solution. G39P when complexed with G40P-ATP inactivates the single-stranded DNA binding, ATPase and unwinding activities of G40P, and such effects are reversed by increasing amounts of G38P. Unwinding of a forked substrate by G40P-ATP is increased about tenfold by the addition of G38P and G39P to the reaction mixture. The specific protein-protein interactions between oriL-bound G38P and the G39P-G40P-ATPgammaS complex are necessary for helicase delivery to the SPP1 replication origin. Formation of G38P-G39P heterodimers releases G40P-ATPgammaS from the unstable oriL-G38P-G39P-G40P-ATPgammaS intermediate. G40P-ATPgammaS binds to the origin region, the uncomplexed G38P fraction remains bound to oriL, and the G38P-G39P heterodimer is lost from the complex. We demonstrate that G39P is a component of an oligomeric nucleoprotein complex which plays an important role in the initiation of SPP1 replication.
Resumo:
In order to contribute to the debate about southern glacial refugia used by temperate species and more northern refugia used by boreal or cold-temperate species, we examined the phylogeography of a widespread snake species (Vipera berus) inhabiting Europe up to the Arctic Circle. The analysis of the mitochondrial DNA (mtDNA) sequence variation in 1043 bp of the cytochrome b gene and in 918 bp of the noncoding control region was performed with phylogenetic approaches. Our results suggest that both the duplicated control region and cytochrome b evolve at a similar rate in this species. Phylogenetic analysis showed that V. berus is divided into three major mitochondrial lineages, probably resulting from an Italian, a Balkan and a Northern (from France to Russia) refugial area in Eastern Europe, near the Carpathian Mountains. In addition, the Northern clade presents an important substructure, suggesting two sequential colonization events in Europe. First, the continent was colonized from the three main refugial areas mentioned above during the Lower-Mid Pleistocene. Second, recolonization of most of Europe most likely originated from several refugia located outside of the Mediterranean peninsulas (Carpathian region, east of the Carpathians, France and possibly Hungary) during the Mid-Late Pleistocene, while populations within the Italian and Balkan Peninsulas fluctuated only slightly in distribution range, with larger lowland populations during glacial times and with refugial mountain populations during interglacials, as in the present time. The phylogeographical structure revealed in our study suggests complex recolonization dynamics of the European continent by V. berus, characterized by latitudinal as well as altitudinal range shifts, driven by both climatic changes and competition with related species.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Kirjoitus on lisäys professorien Olli Halkan ja Veikko Sorsan artikkeleihin TT -lehdessä 2 ja 3/2004.
Resumo:
Vastine Olli Halkan kirjoitukseen TT -lehdessä 2/2004
Resumo:
Phosphate (Pi) acquisition of crops via arbuscular mycorrhizal (AM) symbiosis acquires increasing importance due to the limited rock Pi reserves and the demand for environmentally sustainable agriculture. However, the symbiotic Pi uptake machinery has not been characterized in any monocotyledonous plant species. Among these, rice is the primary staple food for more than half of the human population and thus central for future food security. However, the relevance of the AM symbiosis for rice Pi nutrition is presently unclear. Here, we show that 70% of the overall Pi acquired by rice is delivered via the symbiotic route. To better understand this pathway we combined genetic, molecular and physiological approaches to determine the specific functions of the two rice Pi transporters, PT11 and PT13, which are expressed only during AM symbiosis. The PT11 lineage of proteins is present in mono- and dicotyledons whereas PT13, while found across the Poaceae, is absent from dicotyledons. Surprisingly, mutations in either PT11 or PT13 affected fungal colonization and arbuscule formation demonstrating that both genes are essential for AM symbiosis between rice and Glomus intra.rad.ices. Importantly, for symbiotic Pi uptake, only PT11 is necessary and sufficient. We found that mycorrhizal rice, remarkably, received almost all Pi via the symbiotic route. Such dominating mycorrhizal Pi uptake was found in plants grown under controlled conditions as well as in field soils, suggesting that the AM symbiosis is relevant for the Pi nutrition of field grown rice. Development of smaller arbuscules in PT11 mutants suggested that symbiotic Pi signaling is required for fungal nourishment by the plant. However, co-culture of mutant with wild type nurse plants did not restore normal arbuscule size in mutant roots, indicating that other factors than malnutrition accounted for the altered arbuscule phenotype. Surprisingly, the loss of PT13 did not affect symbiotic Pi uptake although it impacted arbuscule morphology, suggesting that PT13 is involved in signaling during arbuscule development. However, induction of PT13 was not only monitored in arbusculated cells but also in inner cortex cells of non-inoculated roots of plants grown under high Pi fertilization conditions. According to preliminary observations, PT13 localized at the tonoplast in arbusculated and non-arbusculated cells, suggesting that it might be involved in transporting Pi into the vacuole, possibly for maintaining cellular Pi homeostasis. The further investigation showed that fungal colonization level was significantly affected in the crown roots of two ptlS mutant alleles, but not in large lateral roots, implying the possible role of PT13 for maintaining Pi homeostasis in the crown roots. - L'acquisition de phosphate (Pi) par les plantes cultivées s'effectue grâce à une symbiose mycorhizienne arbasculaire (AM). L'étude de cette symbiose devient fondamentale puisque d'une part, les réserves en phosphate minéral sont limitées, et, d'autre part, la demande pour une agriculture écologiquement soutenable se renforce. La machinerie d'absorption symbiotique du phosphate n'est cependant pas encore élucidée chez les plantes monocotylédones. Parmi celles-ci, le riz occupe une place primordiale. Aliment de base pour plus de la moitié de la population mondiale, il revêt de ce fait une dimension essentielle en termes de sécurité alimentaire. Pourtant, l'importance de la symbiose AM chez le riz dans le processus d'acquisition du phosphate n'est, encore de nos jours, que peu comprise. Dans cette étude, nous montrons que 70% du phosphate acquis par le riz est mis à disposition de la plante grâce à la symbiose AM. Afin de mieux comprendre ce mécanisme, nous avons employé des approches physiologiques et génétiques nous permettant de déterminer les fonctions spécifiques de deux transporteurs de Pi, PT11 et PT13, présents chez le riz et exprimés uniquement durant la symbiose AM. La famille de gènes à laquelle appartient PT11 est présente chez les monocotylédones ainsi que chez les dicotylédones tandis que PT13, bien que retrouvé au sein des Poaceae, est absent chez les dicotylédones. Etonnamment, des versions mutées de PT11 ou de PT13 affectent la colonisation par le champignon endo-mycorhizien ainsi que la formation d'arbuscules, démontrant l'importance de ces deux gènes dans la symbiose AM entre le riz et Glomus intraradices. Il est à noter que seul PT11 se révèle nécessaire et suffisant pour l'apport de Pi grâce à la symbiose. Nous avons observé que la presque totalité du phosphate dont dispose le riz lors d'une symbiose AM provient du champignon. De telles proportions ont été observées tant chez des plantes cultivées en conditions contrôlées que chez des plantes cultivées dans les champs. Cela suggère l'importance de la symbiose AM dans le processus d'acquisition du Pi chez le riz cultivé à l'extérieur. Le développement d'arbuscules plus petits chez le mutant PT11 tend à montrer qu'une voie signalétique impliquant le Pi symbiotique est nécessaire pour l'entretien du champignon par la plante. Toutefois, une co-culture du mutant avec des plantes sauvages ne permet pas de restaurer des arbuscules de taille normale dans les racines du mutant. Ce résultat indique le rôle de facteurs autres que la malnutrition aboutissant à la formation d'arbuscules altérés. Si la perte de PT13 n'affecte pas l'acquisition de phosphate symbiotique, la morphologie de l'arbuscule est, quant à elle, modifiée. Ceci suggère un rôle de PT13 durant le développement de l'arbuscule. Or, l'induction de PT13 est non seulement détectée dans des cellules contenant des arbuscules mais également dans des cellules du cortex, ceci chez des plantes cultivées sans champignon mais dans des conditions de fortes concentrations en engrais phosphaté. En accord avec des observations précédentes, PT13 est localisé au niveau du tonoplaste des cellules contenant ou non des arbuscules. Ceci suggère que PT13 pourrait être impliqué dans le transport du Pi vers la vacuole, éventuellement pour maintenir une certaine homéostasie du phosphate. Dans cette étude, nous démontrons également que le niveau de colonisation par le champignon est affecté de manière significative dans les racines principales des deux allèles du mutants ptl3, mais pas dans les grosses racines latérales. Cela impliquerait un rôle possible de PT13 dans le maintien de l'homéostasie du phosphate dans les racines principales. RESUME POUR UN LARGE PUBLIC Le phosphate (Pi), l'un des éléments minéraux essentiel au développement des plantes, se trouve généralement en faible quantité dans le sol, limitant ainsi la croissance des plantes. Le rendement de la production agricole dépend dès lors de l'addition d'engrais contenant du phosphate inorganique (Pi), obtenu à partir de ressources minières riches en phosphate. Or, ces ressources devraient être épuisées d'ici la fin du siècle. Les racines des plantes possèdent des transporteurs de phosphate efficaces leur permettant d'acquérir rapidement le Pi présent dans le sol. Comme le Pi s'avère immobile dans le sol, l'absorption rapide par les racines crée des zones pauvres en Pi autour des systèmes racinaires. Pour surmonter cet obstacle, les plantes ont développé une symbiose avec des champignons endomycorhiziens, la symbiose mycorhizienne arbusculaire (AM). Cette association leur donne accès à d'autres ressources en phosphate puisque le mycélium de ces champignons se développe sur une surface 100 fois supérieure à celle des racines. Cela augmente considérablement la surface de nutrition, dépassant ainsi la zone appauvrie en Pi. Le phosphate, transporté grâce au champignon jusqu'à l'intérieur des racines, est fourni à la plante par le biais de structures établies à l'intérieur des cellules végétales, appelées arbuscules. De leur côté, les plantes possèdent des transporteurs spécifiques afin de recevoir le Pi fourni par les champignons. A l'heure actuelle, la machinerie nécessaire à cette absorption a été uniquement décrite chez des plantes dicotylédones. Or, comprendre l'apport de phosphate par les champignons mycorhiziens s'avère particulièrement pertinent dans le cas des espèces monocotylédones cultivées telles que les céréales. Ces dernières constituent en effet la majeure partie de l'alimentation humaine. Parmi les céréales, le riz demeure l'aliment de base de la population mondiale, d'où son importance en terme de sécurité alimentaire. Durant mon travail de thèse, j'ai identifié et caractérisé le transporteur du riz impliqué dans l'apport de phosphate par ce type de symbiose AM. J'ai également démontré que le riz, lorsqu'il vit en symbiose, bénéficie de la presque totalité du Pi transporté par le champignon. Environ 40% de la production globale de riz est cultivée dans des conditions permettant la symbiose avec des mycorhizes arbusculaires. Les variétés de riz adaptées à ces conditions aérobiques deviennent des alternatives favorables aux cultivars actuels nécessitant une forte irrigation. Elles se révèlent en effet plus tolérantes aux pénuries d'eau et permettent l'utilisation de pratiques agricoles moins intensives. Les données présentées dans cette étude enrichissent nos connaissances concernant l'absorption du phosphate chez le riz grâce à la symbiose AM. Ces connaissances peuvent s'avérer décisives pour le développement de cultivars du riz plus adaptés à une agriculture écologiquement soutenable.
Resumo:
Vastine TT -lehden numerossa 8/2003 olleeseen Jani Rydmanin kommenttiin Pekkan Nuortevan Luonnon tutkijassa olleeseen artikkeliin
Resumo:
Epigenetic silencing of the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) by promoter methylation predicts successful alkylating agent therapy, such as with temozolomide, in glioblastoma patients. Stratified therapy assignment of patients in prospective clinical trials according to tumor MGMT status requires a standardized diagnostic test, suitable for high-throughput analysis of small amounts of formalin-fixed, paraffin-embedded tumor tissue. A direct, real-time methylation-specific PCR (MSP) assay was developed to determine methylation status of the MGMT gene promoter. Assay specificity was obtained by selective amplification of methylated DNA sequences of sodium bisulfite-modified DNA. The copy number of the methylated MGMT promoter, normalized to the beta-actin gene, provides a quantitative test result. We analyzed 134 clinical glioma samples, comparing the new test with the previously validated nested gel-based MSP assay, which yields a binary readout. A cut-off value for the MGMT methylation status was suggested by fitting a bimodal normal mixture model to the real-time results, supporting the hypothesis that there are two distinct populations within the test samples. Comparison of the tests showed high concordance of the results (82/91 [90%]; Cohen's kappa = 0.80; 95% confidence interval, 0.82-0.95). The direct, real-time MSP assay was highly reproducible (Pearson correlation 0.996) and showed valid test results for 93% (125/134) of samples compared with 75% (94/125) for the nested, gel-based MSP assay. This high-throughput test provides an important pharmacogenomic tool for individualized management of alkylating agent chemotherapy.
Resumo:
A general understanding of interactions between DNA andoppositely charged compounds forms the basis for developing novelDNA-based materials, including gel particles. The association strength,which is altered by varying the chemical structure of the cationiccosolute, determines the spatial homogeneity of the gelation process,creating DNA reservoir devices and DNA matrix devices that can bedesigned to release either single- (ssDNA) or double-stranded(dsDNA) DNA. This paper reviews the preparation of DNA gelparticles using surfactants, proteins and polysaccharides. Particlemorphology, swelling/dissolution behaviour, degree of DNAentrapment and DNA release responses as a function of the nature ofthe cationic agent used are discussed. Current directions in thehaemocompatible and cytotoxic characterization of these DNA gelparticles have been also included.
Resumo:
Introduction: Prior repeated-sprints (6) has become an interesting method to resolve the debate surrounding the principal factors that limits the oxygen uptake (V'O2) kinetics at the onset of exercise [i.e., muscle O2 delivery (5) or metabolic inertia (3)]. The aim of this study was to compare the effects of two repeated-sprints sets of 6x6s separated by different recovery duration between the sprints on V'O2 and muscular de-oxygenation [HHb] kinetics during a subsequent heavy-intensity exercise. Methods: 10 male subjects performed a 6-min constant-load cycling test (T50) at intensity corresponding to half of the difference between V'O2max and the ventilatory threshold. Then, they performed two repeated-sprints sets of 6x6s all-out separated by different recovery duration between the sprints (S1:30s and S2:3min) followed, after 7-min-recovery, by the T50 (S1T50 and S2T50, respectively). V'O2, [HHb] of the vastus lateralis (VL) and surface electromyography activity [i.e., root-mean-square (RMS) and the median frequency of the power density spectrum (MDF)] from VL and vastus medialis (VM) were recorded throughout T50. Models using a bi-exponential function for the overall T50 and a mono-exponential for the first 90s of T50 were used to define V'O2 and [HHb] kinetics respectively. Results: V'O2 mean value was higher in S1 (2.9±0.3l.min-1) than in S2 (1.2±0.3l.min-1); (p<0.001). The peripheral blood flow was increased after sprints as attested by a higher basal heart rate (HRbaseline) (S1T50: +22%; S2T50: +17%; p≤0.008). Time delay [HHb] was shorter for S1T50 and S2T50 than for T50 (-22% for both; p≤0.007) whereas the mean response time of V'O2 was accelerated only after S1 (S1T50: 32.3±2.5s; S2T50: 34.4±2.6s; T50: 35.7±5.4s; p=0.031). There were no significant differences in RMS between the three conditions (p>0.05). MDF of VM was higher during the first 3-min in S1T50 than in T50 (+6%; p≤0.05). Conclusion: The study show that V'O2 kinetics was speeded by prior repeated-sprints with a short (30s) but not a long (3min) inter-sprints-recovery even though the [HHb] kinetics was accelerated and the peripheral blood flow was enhanced after both sprints. S1, inducing a greater PCr depletion (1) and change in the pattern of the fibres recruitment (increase in MDF) compared with S2, may decrease metabolic inertia (2), stimulate the oxidative phosphorylation activation (4) and accelerate V'O2 kinetics at the beginning of the subsequent high-intensity exercise.
Resumo:
Selostus: Korjuuaika ja typpilannoitus vaikuttavat rehukasvien radiocesiumpitoisuuteen
Resumo:
Owl pellets contain a good skeletal record of the small mammals consumed, and correspond to the undigested portions of prey which are regurgitated. These pellets are easy to find at the roosting site of owls. As it has been demonstrated that amplifiable DNA can be isolated from ancient bone remains, the possibility of using owl pellets as a source of DNA for small mammal genetics studies via the polymerase chain reaction has been investigated. The main uncertainties when isolating DNA from such a material are firstly the possibility that the extracted DNA would be too degraded during the digestion in the stomach of the owl, and secondly that extensive cross-contaminations could occur among the different prey consumed. The results obtained clearly demonstrate that cross-contamination does not occur, and that mitochondrial and nuclear DNA can be amplified using skulls of small mammals found in owl pellets as a source of DNA. The relative efficiency of two methods of DNA extraction is estimated and discussed. Thus, owl pellets represent a non-invasive sampling technique which provides a valuable source of DNA for studying population genetics of small mammals.
Resumo:
The intracellular location of nucleic acid sensors prevents recognition of extracellular self-DNA released by dying cells. However, on forming a complex with the endogenous antimicrobial peptide LL37, extracellular DNA is transported into endosomal compartments of plasmacytoid dendritic cells, leading to activation of Toll-like receptor-9 and induction of type I IFNs. Whether LL37 also transports self-DNA into nonplasmacytoid dendritic cells, leading to type I IFN production via other intracellular DNA receptors is unknown. Here we found that LL37 very efficiently transports self-DNA into monocytes, leading the production of type I IFNs in a Toll-like receptor-independent manner. This type I IFN induction was mediated by double-stranded B form DNA, regardless of its sequence, CpG content, or methylation status, and required signaling through the adaptor protein STING and TBK1 kinase, indicating the involvement of cytosolic DNA sensors. Thus, our study identifies a novel link between the antimicrobial peptides and type I IFN responses involving DNA-dependent activation of cytosolic sensors in monocytes.