897 resultados para DNA Sequence, Hidden Markov Model, Bayesian Model, Sensitive Analysis, Markov Chain Monte Carlo


Relevância:

100.00% 100.00%

Publicador:

Resumo:

A sensitive, specific polymerase chain reaction-based assay was developed for the detection of the causal agent of ratoon stunting disease of sugarcane, Clavibacter xyli subsp. xyli. This assay uses oligonucleotide primers derived from the internal transcribed spacer region between the 16S and 23S rRNA genes of the bacterial rRNA operon. The assay is specific for C. xyli subsp. xyli and does not produce an amplification product from the template of the closely related bacterium C. xyli subsp. cynodontis, nor from other bacterial species. The assay was successfully applied to the detection of C. xyli subsp. xyli in fibrovascular fluid extracted from sugarcane and was sensitive to approximately 22 cells per PCR assay. A multiplex PCR test was also developed which identified and differentiated C. xyli subsp. xyli and C. xyli subsp. cynodontis in a single PCR assay.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Natural killer (NK) cells are an important component of the innate cellular immune system. They are particularly important during the early immune responses following virus infection, prior to the induction of cytotoxic T cells (CTL). Unlike CTL, which recognize specific peptides displayed on the surface of cells by class I MHC, NK cells respond to aberrant expression of cell surface molecules, in particular class I MHC, in a non-specific manner. Thus, cells expressing low levels of surface class I MHC are susceptible to recognition by NK cells, with concomitant triggering of cytolytic and cytokine-mediated responses. Many viruses, including the cytomegaloviruses, downregulate cell surface MHC class I: this is likely to provide protection against CTL-mediated clearance of infected cells, but may also render infected cells sensitive to NK-cell attack. This review focuses upon cytomegalovirus-encoded proteins that are believed to promote evasion of NK-cell-mediated immunity. The class I MHC homologues, encoded by all cytomegaloviruses characterised to date, have been implicated as molecular 'decoys', which may mimic the ability of cellular MHC class I to inhibit NK-cell functions. Results from studies in vitro are not uniform, but in general they support the proposal that the class I homologues engage inhibitory receptors from NK cells and other cell types that normally interact with cellular class I. Consistent with this, in vivo studies of murine cytomegalovirus indicate that the class I homologue is required for efficient evasion of NK-cell-mediated clearance. Recently a second murine cytomegalovirus protein, a C-C chemokine homologue, has been implicated as promoting evasion of NK and T-cell-mediated clearance in vivo.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

An analysis of the relationships of the major arthropod groups Was undertaken using mitochondrial genome data to examine the hypotheses that Hexapoda is polyphyletic and that Collembola is more closely related to branchiopod crustaceans than insects. We sought to examine the sensitivity of this relationship to outgroup choice, data treatment. gene choice and optimality criteria used in the phylogenetic analysis of mitochondrial genome data. Additionally we sequenced the mitochondrial genome of ail archaeognathan, Nesomachilis australica. to improve taxon selection in the apterygote insects, a group poorly represented in previous mitochondrial phylogenies. The sister group of the Collembola was rarely resolved in our analyses with a significant level of support. The use of different outgroups (myriapods, nematodes, or annelids + mollusks) resulted in many different placements of Collembola. The way in which the dataset was coded for analysis (DNA, DNA with the exclusion of third codon position and as amino acids) also had marked affects on tree topology. We found that nodal Support was spread evenly throughout the 13 mitochondrial genes and the exclusion of genes resulted in significantly less resolution in the inferred trees. Optimality criteria had a much lesser effect on topology than the preceding factors; parsimony and Bayesian trees for a given data set and treatment were quite similar. We therefore conclude that the relationships of the extant arthropod groups as inferred by mitochondrial genomes are highly vulnerable to outgroup choice, data treatment and gene choice, and no consistent alternative hypothesis of Collembola's relationships is supported. Pending the resolution of these identified problems with the application of mitogenomic data to basal arthropod relationships, it is difficult to justify the rejection of hexapod monophyly, which is well supported on morphological grounds. (c) The Willi Hennig Society 2004.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background/Aims: Approximately four million Africans were taken as slaves to Brazil, where they interbred extensively with Amerindians and Europeans. We have previously shown that while most White Brazilians carry Y chromosomes of European origin, they display high proportions of African and Amerindian mtDNA lineages, because of sex-biased genetic admixture. Methods: We studied the Y chromosome and mtDNA haplogroup structure of 120 Black males from Sao Paulo, Brazil. Results: Only 48% of the Y chromosomes, but 85% of the mtDNA haplogroups were characteristic of sub-Saharan Africa, confirming our previous observation of sexually biased mating. We mined literature data for mtDNA and Y chromosome haplogroup frequencies for African native populations from regions involved in Atlantic Slave Trade. Principal Components Analysis and Bayesian analysis of population structure revealed no genetic differentiation of Y chromosome marker frequencies between the African regions. However, mtDNA examination unraveled considerable genetic structure, with three clusters at Central-West Africa, West Africa and Southeast Africa. A hypothesis is proposed to explain this structure. Conclusion: Using these mtDNA data we could obtain for the first time an estimate of the relative ancestral contribution of Central-West (0.445), West (0.431) and Southeast Africa (0.123) to African Brazilians from Sao Paulo. These estimates are consistent with historical information. Copyright (c) 2008 S. Karger AG, Basel.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Egr-1 and related proteins are inducible transcription factors within the brain recognizing the same consensus DNA sequence. Three Egr DNA-binding activities were observed in regions of the naive rat brain. Egr-1 was present in all brain regions examined. Bands composed, at least in part, of Egr-2 and Egr-3 were present in different relative amounts in the cerebral cortex, striatum, hippocampus, thalamus, and midbrain. All had similar affinity and specificity for the Egr consensus DNA recognition sequence. Administration of the convulsants NMDA, kainate, and pentylenetetrazole differentially induced Egr-1 and Egr-2/3 DNA-binding activities in the cerebral cortex, hippocampus, and cerebellum. All convulsants induced Egr-1 and Egr-2 immunoreactivity in the cerebral cortex and hippocampus. These data indicate that the members of the Egr family are regulated at different levels and may interact at promoters containing the Egr consensus sequence to fine tune a program of gene expression resulting from excitatory stimuli.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Several differences have been described between neonatal and adult immune responses. The predisposition in early life to Th2-type response or tolerance makes it a susceptible period for infections and allergic sensitization. The aim of this work was to evaluate the effects of CpG-containing oligodeoxynucleotides on neonatal and adult immunization with ovalbumin and Blomia tropicalis extract and compare the CpG effects on B and T cells of neonatal and adult mice. Mice that received CpG showed reduced immunoglobulin E (IgE) antibody production in both neonatal and adult periods, in parallel to increased IgG2a antibody levels. We observed that spleen cells of mice that received CpG in early life produced increased amounts of interferon-gamma upon anti-CD3 stimulation. Negative regulation of IgE response was more pronounced in adult than neonate mice; further, CpG decreased anaphylactic antiovalbumin IgG1 only in adults. Also, an upregulation of toll-like receptor 9 expression was detected in adult B cells, but not in neonatal, upon CpG stimuli. Neonatal B cells showed enhanced interleukin (IL)-10 expression and decreased IL-6 levels than adult B cells in response to CpG. When we analyzed in vitro activation of CD4+ T cells, an increased expression of B7 molecules on T cells in neonates was suppressed by CpG. Altogether, we verified qualitative and quantitative evidences regarding CpG effect on neonatal and adult allergens immunizations, which points to the importance of understanding neonatal immune system to establish immunomodulatory strategies for prevention of allergic diseases.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Neo-intima development and atherosclerosis limit long-term vein graft use for revascularization of ischaemic tissues. Using a rat model, which is technically less challenging than smaller rodents, we provide evidence that the temporal morphological, cellular, and key molecular events during vein arterialization resemble the human vein graft adaptation. Right jugular vein was surgically connected to carotid artery and observed up to 90 days. Morphometry demonstrated gradual thickening of the medial layer and important formation of neo-intima with deposition of smooth muscle cells (SMC) in the subendothelial layer from day 7 onwards. Transmission electron microscopy showed that SMCs switch from the contractile to synthetic phenotype on day 3 and new elastic lamellae formation occurs from day 7 onwards. Apoptosis markedly increased on day 1, while alpha-actin immunostaining for SMC almost disappeared by day 3. On day 7, cell proliferation reached the highest level and cellular density gradually increased until day 90. The relative magnitude of cellular changes was higher in the intima vs. the media layer (100 vs. 2 times respectively). Cyclin-dependent kinase inhibitors (CDKIs) p27(Kip1) and p16(INKA) remained unchanged, whereas p21(Cip1) was gradually downregulated, reaching the lowest levels by day 7 until day 90. Taken together, these data indicate for the first time that p21(Cip1) is the main CDKI protein modulated during the arterialization process the rat model of vein arterialization that may be useful to identify and validate new targets and interventions to improve the long-term patency of vein grafts.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Surrogate methods for detecting lateral gene transfer are those that do not require inference of phylogenetic trees. Herein I apply four such methods to identify open reading frames (ORFs) in the genome of Escherichia coli K12 that may have arisen by lateral gene transfer. Only two of these methods detect the same ORFs more frequently than expected by chance, whereas several intersections contain many fewer ORFs than expected. Each of the four methods detects a different non-random set of ORFs. The methods may detect lateral ORFs of different relative ages; testing this hypothesis will require rigorous inference of trees. (C) 2001 Federation of European Microbiological Societies. Published by Elsevier Science BN. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

By exhibiting a violation of a novel form of the Bell-CHSH inequality, Żukowski has recently established that the quantum correlations exploited in the standard perfect teleportation protocol cannot be recovered by any local hidden variables model. In the case of imperfect teleportation, we show that a violation of a generalized form of Żukowski's teleportation inequality can only occur if the channel state, considered by itself, already violates a Bell-CHSH inequality. On the other hand, the fact that the channel state violates a Bell-CHSH inequality is not sufficient to imply a violation of Żukowski's teleportation inequality (or any of its generalizations). The implication does hold, however, if the fidelity of the teleportation exceeds ≈ 0.90. © 2001 Elsevier Science B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

An important feature of improving lattice gas models and classical isotherms is the incorporation of a pore size dependent capacity, which has hitherto been overlooked. In this paper, we develop a model for predicting the temperature dependent variation in capacity with pore size. The model is based on the analysis of a lattice gas model using a density functional theory approach at the close packed limit. Fluid-fluid and solid-fluid interactions are modeled by the Lennard-Jones 12-6 potential and Steele's 10-4-3, potential respectively. The capacity of methane in a slit-shaped carbon pore is calculated from the characteristic parameters of the unit cell, which are extracted by minimizing the grand potential of the unit cell. The capacities predicted by the proposed model are in good agreement with those obtained from grand canonical Monte Carlo simulation, for pores that can accommodate up to three adsorbed layers. Single particle and pair distributions exhibit characteristic features that correspond to the sequence of buckling and rhombic transitions that occur as the slit pore width is increased. The model provides a useful tool to model continuous variation in the microstructure of an adsorbed phase, namely buckling and rhombic transitions, with increasing pore width. (C) 2002 American Institute of Physics.