Environmental isolation, biochemical identification, and antifungal drug susceptibility of Cryptococcus species

Introduction The incidence of opportunistic fungal infections has increased in recent years and is considered an important public health problem. Among systemic and opportunistic mycoses, cryptococcosis is distinguished by its clinical importance due to the increased risk of infection in individuals infected by human immunodeficiency virus. Methods To determine the occurrence of pathogenic Cryptococcus in pigeon excrement in the City of Araraquara, samples were collected from nine environments, including state and municipal schools, abandoned buildings, parks, and a hospital. The isolates were identified using classical tests, and susceptibility testing for the antifungal drugs (fluconazole, itraconazole, voriconazole, and amphotericin B) independently was also performed. After collection, the excrement samples were plated on Niger agar and incubated at room temperature. Results A total of 87 bird dropping samples were collected, and 66.6% were positive for the genus Cryptococcus. The following species were identified: Cryptococcus neoformans (17.2%), Cryptococcus gattii (5.2%), Cryptococcus ater (3.5%), Cryptococcus laurentti (1.7%), and Cryptococcus luteolus (1.7%). A total of 70.7% of the isolates were not identified to the species level and are referred to as Cryptococcus spp. throughout the manuscript. Conclusions Although none of the isolates demonstrated resistance to antifungal drugs, the identification of infested areas, the proper control of birds, and the disinfection of these environments are essential for the epidemiological control of cryptococcosis.

Contaminação por fungos antes e após limpeza e desinfecção de colchões hospitalares

OBJECTIVE: To verify the existence of fungal contamination prior to and following the cleaning and disinfection process of hospital mattresses used by patients with Candidemia. METHODS: Cross-sectional study analyzing 25 mattresses used by patients with Candidemia confirmed by blood culture from different hospital wards. The study made use of convenience samples. After growing the samples in an Agar Sabouraud Dextrose environment, isolated yeasts were identified by macroscopic, microscopic and physiologic characteristics. RESULTS: Analyses showed 15 (60%) mattresses contaminated by Candida spp. From these, 10 (66.7%) and five (33.3%) mattresses corresponded respectively to the collection prior to and following disinfection, with Candida parapsilosis being the isolated species with the highest frequency. CONCLUSION: Considering that half of the mattresses remained contaminated after cleaning and disinfection, there is a risk that these mattresses may act as potential secondary reservoirs in the infection chain.

Comparison of the hemolytic activity between C. albicans and non-albicans Candida species

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

The antimicrobial effects of Citrus limonum and Citrus aurantium essential oils on multi-species biofilms

The aim of this study was to evaluate the effects of Citrus limonum and Citrus aurantium essential oils (EOs) compared to 0.2% chlorhexidine (CHX) and 1% sodium hypochlorite (NaOCl) on multi-species biofilms formed by Candida albicans, Enterococcus faecalis and Escherichia coli. The biofilms were grown in acrylic disks immersed in broth, inoculated with microbial suspension (106 cells/mL) and incubated at 37°C / 48 h. After the biofilms were formed, they were exposed for 5 minutes to the solutions (n = 10): C. aurantium EO, C. limonum EO, 0.2% CHX, 1% NaOCl or sterile saline solution [0.9% sodium chloride (NaCl)]. Next, the discs were placed in sterile 0.9% NaCl and sonicated to disperse the biofilms. Tenfold serial dilutions were performed and the aliquots were seeded onto selective agar and incubated at 37°C / 48 h. Next, the number of colony-forming units per milliliter was counted and analyzed statistically (Tukey test, p ≤ 0.05). C. aurantium EO and NaOCl inhibited the growth of all microorganisms in multi-species biofilms. C. limonum EO promoted a 100% reduction of C. albicans and E. coli, and 49.3% of E. faecalis. CHX was less effective against C. albicans and E. coli, yielding a reduction of 68.8% and 86.7%, respectively. However, the reduction of E. faecalis using CHX (81.7%) was greater than that obtained using C. limonum EO. Both Citrus limonum and Citrus aurantium EOs are effective in controlling multi-species biofilms; the microbial reductions achieved by EOs were not only similar to those of NaOCl, but even higher than those achieved by CHX, in some cases.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Biological aspects of Aphis gossypii Glöver, 1877 (Hemiptera: Aphididae) on colored lint cotton cultivars

This paper outlines the results of a study into the biological aspects of Aphis gossypii Glöver on colored cotton cultivars through the construction of life tables. In addition, we evaluate the influence of density of gossypol glands and trichomes of leaves on the biology of the aphid. Tests were conducted in a climate chamber at 25 ± 2°C, with relative humidity (RH) at 70 ± 10%, and a photophase of 12 hours, using the cultivars BRS Rubi, BRS Safira, and BRS Verde. Newly hatched nymphs were individually isolated in petri dishes containing leaf discs of cotton cultivars on a layer of water-agar (1%) of approximately 5 mm thick. An evaluation of the trichomes and gossypol gland densities of the cotton leaf plants was performed under a stereomicroscope, delimited to an area of 1 cm², and a count and identification of those on the surface was made. The feed substrates that were evaluated influenced the nymphal stage of A. gossypii. BRS Verde provided the shortest duration and BRS Safira was the longest during this phase. The cultivar BRS Verde, with the lowest density of trichomes, provided a large number of nymphs and led to a higher net reproductive rate (R0). Given these results, conclusions can be drawn that the colored cotton cultivars influence the duration of nymphal and adult stages of A. gossypii. The cultivar with a high density of trichomes on leaves (BRS Safira) adversely affects the fertility parameters of A. gossypii.

Epidemiologia molecular aplicada ao monitoramento de estirpes de Staphylococcus aureus na produção de queijo Minas frescal

We studied the molecular epidemiology of Staphylococcus aureus strains potentially toxigenic, isolated from the production process of Minas frescal cheese in a small dairy plant in the state of São Paulo. For this, samples were taken during the period from June 2008 to July 2009. Samples were collected from the surface of the receiving and storage tanks of raw milk, the surface of the balance tank of pasteurized milk, the water supply system, the pipes and equipments, the hands of the handler and from the packaged cheese, totaling 140 samples. The colonies isolated on Baird-Parker Agar confirmed as Gram positive and positive for catalase, coagulase and acetoin production, were submitted to extraction of bacterial DNA using the Invitek - Uniscience® kit. Confirmation of the isolated species and enterotoxins SEA, SEB, SEC, SED and TSST-1 toxin was carried out through the amplification of specific fragments of chromosomal DNA. Among the 74 strains of isolated coagulase-positive staphylococci, only 41 (55.4%) strains were confirmed as Staphylococcus aureus, of which 25 (61.0%) were positive to the presence of staphylococcal toxins. The most frequently identified enterotoxin was SEA. The toxigenic strains of Staphylococcus aureus were more frequently isolated from hands of the handler (16.0%), raw milk receiving tank (12.0%), pasteurized milk for cheese making (12.0%) and fresh white cheese ready for consumption (12.0%).

Caracterização da suinocultura em Mossoró, Rio Grande do Norte: aspectos sanitários e riscos de zoonoses

Pós-graduação em Medicina Veterinária - FCAV

Ocorrência e identificação molecular de espécies do gênero Mycobacterium e marcadores de virulência em linhagens de Rhodococcus equi isoladas de linfonodos e das fezes de suínos de abatedeouro

Pós-graduação em Medicina Veterinária - FMVZ

Produção e aplicação de enzimas na redução de biofilme de Candida albicans

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Atividade antimicrobiana da carbodiimida (EDC) sobre microorganismos presentes em lesões cariosas

Pós-graduação em Ciências Odontológicas - FOAR

Evaluation of seafood quality market in Baixada Santista/SP

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Sero-epidemiological survey for brucellosis, leptospirosis, and toxoplasmosis in free-ranging Alouatta caraya and Callithrix penicillata from Sao Paulo State, Brazil

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Prevalence and Serological Diagnosis of Relapse in Paracoccidioidomycosis Patients

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Streptococcus Mutans Photoinactivation by Combination of Short Exposure of a Broad-Spectrum Visible Light and Low Concentrations of Photosensitizers

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)