Changes in the antioxidant properties of protein solutions in the presence of epigallocatechin gallate

beta-Casein and alpha-casein showed radical-scavenging activities in aqueous solution, whereas bovine serum albumin (BSA), alpha-lactalbumin and P-lactoglobulin showed much weaker antioxidant activity, when assessed by the 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) radical-scavenging assay. However, beta-casein and alpha-casein showed reduced antioxidant activity after storage at 30 degrees C. An increase in radical- scavenging activity and a fall in fluorescence of the protein component were evident after 6 h, when BSA, beta-lactoglobulin or casein were mixed with EGCG, and excess EGCG was removed, indicating the formation of a complex with this protein on mixing. Storage of all the proteins with EGCG at 30 degrees C caused an increase in the antioxidant activity of the isolated protein component after separation from excess EGCG. This showed that EGCG was reacting with the proteins and that the protein-bound catechin had antioxidant properties. The reaction of EGCG with BSA, casein and beta-lactoglobulin was confirmed by the loss of fluorescence of the protein on storage, and the increase in UV absorbance between 250 and 400 nm. The increase in antioxidant activity of BSA after storage with EGCG was confirmed by the ferric reducing antioxidant potential (FRAP) and the oxygen radical antioxidant capacity (ORAC) assays. (c) 2006 Elsevier Ltd. All rights reserved.

Molecular characterization and fumonisin production by Fusarium verticillioides isolated from corn grains of different geographic origins in Brazil

Gibberella moniliformis is most commonly associated with maize worldwide and produces high levels of fumonisins, some of the most agriculturally important mycotoxins. Studies demonstrate that molecular methods can be helpful for a rapid identification of Fusarium species and their levels of toxin production. The purpose of this research was to apply molecular methods (AFLP, TEF-1 alpha partial gene sequencing and PCR based on MAT alleles) for the identification of Fusarium species isolated from Brazilian corn and to verify if real time RT-PCR technique based on FUM1 and FUM19 genes is appropriated to estimate fumonisins B(1) and B(2) production levels. Among the isolated strains, 96 were identified as Fusarium verricillioides, and four as other Fusarium species. Concordant phylogenies were obtained by AFLP and TEF-1 alpha sequencing, permitting the classification of the different species into distinct clades. Concerning MAT alleles, 70% of the F. verricillioides isolates carried the MAT-1 and 30% MAT-2. A significant correlation was observed between the expression of the genes and toxin production r=0.95 and r=0.79 (correlation of FUM1 with FB(1) and FB(2), respectively, P < 0.0001): r=0.93 and r =0.78 (correlation of FUM19 with FB(1) and FB(2). respectively, P < 0.0001). Molecular methods used in this study were found to be useful for the rapid identification of Fusarium species. The high and significant correlation between FUM1 and FUM19 expression and fumonisins production suggests that real time RT-PCR is suitable for studies considering the influence of abiotic and biotic factors on expression of these genes. This is the first report concerning the expression of fumonisin biosynthetic genes in Fusarium strains isolated from Brazilian agricultural commodity. (c) 2010 Elsevier B.V. All rights reserved.

The influence of albumin on the anodic dissolution of chromium present in UNSS31254 stainless steel in chloride environment

The influence of bovine serum albumin (BSA) on the anodic dissolution of chromium present in UNS S31254 stainless steel (SS) in 0.15 mol L-1 NaCl at 37.0 +/- 0.5 degrees C has been studied, using anodic potentiostatic polarization curves and optical emission spectroscopy. Electrochemical results have shown that BSA has little effect on the transpassivation potential (E-T) and on the passivation current density values. However on the passivation range, BSA diminishes the intensity of the anodic wave seen at about E=750mV versus SCE attributed to Cr(III)/Cr(VI) oxidation. Optical emission spectroscopy results have shown that BSA prevents the anodic dissolution of chromium to occur and minimizes iron dissolution above the transpassivation potential (E=1160 mV versus SCE). (C) 2007 Elsevier B.V. All rights reserved.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

GH overexpression causes muscle hypertrophy independent from local IGF-I in a zebrafish transgenic model

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Cladophialophora saturnica sp nov., a new opportunistic species of Chaetothyriales revealed using molecular data

While many members of the black yeasts genus Cladophialophora have been reported to cause diseases in humans, understanding of their natural niche is frequently lacking. Some species can be recovered from the natural environment by means of selective isolation techniques. The present study focuses on a Cladophialophora strain that caused an interdigital tinea nigra-like lesion in a HIV-positive Brazilian child. The fungal infection was successfully treated with oxiconazole. Similar strains had been recovered from the environment in Brazil, Uruguay and the Netherlands. The strains were characterized by sequencing the Internal Transcribed Spacer (ITS) regions and the small subunit (SSU) of the nuclear ribosomal RNA gene, as well as the elongation factor 1-alpha (EF1) gene. Since no match with any known species was found, it is described as the new species, Cladophialophora saturnica.

Subcellular localization of proteins labeled with GFP in Xanthomonas citri ssp citri: targeting the division septum

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

AN IMPROVED ELECTROPHORETIC METHOD FOR THE DETERMINATION OF SERUM MILK PROTEIN VARIANTS IN GYR-HOLSTEIN COWS

Milk serum proteins such as alpha-lactalbumin (ALA) and beta-lactoglobulin (BLG) present biochemical polymorphism which is under the control of codominant autosomal alleles. In the present report, we propose modifications of traditional electrophoretic techniques such as increasing the running gel concentration from 5 to 10% and the addition of 5 M urea to the stacking gel, which permitted the detection of two variants (A and B) at the ALA and BLG loci. About 8 mul of milk serum (6 mg/ml protein) and 10 pl of total fresh milk were applied. Bovine serum albumin (BSA) and immunolactoglobulins (ILG) could also be discriminated. Total fresh milk was as useful as the purified serum milk proteins for the discrimination of ALA and BLG serum milk protein polymorphism by alkaline vertical slab polyacrylamide gel electrophoresis. However, BSA and ILG ran with caseins, which prevented their characterization in this system.

Effects of Ginkgo biloba on chemically-induced mammary tumors in rats receiving tamoxifen

Background: Ginkgo biloba extract (GbE) is used extensively by breast cancer patients undergoing treatment with Tamoxifen (TAM). Thus, the present study investigated the effects of GbE in female Sprague-Dawley (SD) rats bearing chemically-induced mammary tumors and receiving TAM.Methods: Animals bearing mammary tumors (≥1 cm in diameter) were divided into four groups: TAM [10 mg/kg, intragastrically (i.g.)], TAM plus GbE [50 and 100 mg/kg, intraperitoneally (i.p.)] or an untreated control group. After 4 weeks, the therapeutic efficacy of the different treatments was evaluated by measuring the tumor volume (cm3) and the proportions of each tumor that were alive, necrotic or degenerative (mm2). In addition, labeling indexes (LI%) were calculated for cell proliferation (PCNA LI%) and apoptosis (cleaved caspase-3 LI%), expression of estrogen receptor-alpha (ER-α) and p63 biomarkers.Results: Overall, the tumor volume and the PCNA LI% within live tumor areas were reduced by 83% and 99%, respectively, in all TAM-treated groups when compared to the untreated control group. GbE treatment (100 mg/kg) reduced the proportions of live (24.8%) and necrotic areas (2.9%) (p = 0.046 and p = 0.038, respectively) and significantly increased the proportion of degenerative areas (72.9%) (p = 0.004) in mammary tumors when compared to the group treated only with TAM. The expression of ER-α, p63 and cleaved caspase-3 in live tumor tissues was not modified by GbE treatment.Conclusions: Co-treatment with 100 mg/kg GbE presented a slightly beneficial effect on the therapeutic efficacy of TAM in female SD rats bearing mammary tumors. © 2013 Dias et al.; licensee BioMed Central Ltd.

Interclonal Variations in the Molecular Karyotype of Trypanosoma cruzi: Chromosome Rearrangements in a Single Cell-Derived Clone of the G Strain

Trypanosoma cruzi comprises a pool of populations which are genetically diverse in terms of DNA content, growth and infectivity. Inter- and intra-strain karyotype heterogeneities have been reported, suggesting that chromosomal rearrangements occurred during the evolution of this parasite. Clone D11 is a single-cell-derived clone of the T. cruzi G strain selected by the minimal dilution method and by infecting Vero cells with metacyclic trypomastigotes. Here we report that the karyotype of clone D11 differs from that of the G strain in both number and size of chromosomal bands. Large chromosomal rearrangement was observed in the chromosomes carrying the tubulin loci. However, most of the chromosome length polymorphisms were of small amplitude, and the absence of one band in clone D11 in relation to its reference position in the G strain could be correlated to the presence of a novel band migrating above or below this position. Despite the presence of chromosomal polymorphism, large syntenic groups were conserved between the isolates. The appearance of new chromosomal bands in clone D11 could be explained by chromosome fusion followed by a chromosome break or interchromosomal exchange of large DNA segments. Our results also suggest that telomeric regions are involved in this process. The variant represented by clone D11 could have been induced by the stress of the cloning procedure or could, as has been suggested for Leishmania infantum, have emerged from a multiclonal, mosaic parasite population submitted to frequent DNA amplification/deletion events, leading to a 'mosaic' structure with different individuals having differently sized versions of the same chromosomes. If this is the case, the variant represented by clone D11 would be better adapted to survive the stress induced by cloning, which includes intracellular development in the mammalian cell. Karyotype polymorphism could be part of the T. cruzi arsenal for responding to environmental pressure. © 2013 Lima et al.

Initial description of the phylogeography, population structure and genetic diversity of Atlantic spotted dolphins from Brazil and the Caribbean, inferred from analyses of mitochondrial and nuclear DNA

We provide initial information regarding the population structure and genetic diversity of Stenella frontalis from the Caribbean and southeastern Brazil from analyses of mitochondrial control region sequences and sequences from the first intron of the α-lactalbumin gene. Comparisons with previously described S. frontalis sequences showed a high number of haplotypes shared between populations throughout their distribution range. High diversity was found for southeastern Brazil and Caribbean samples, and population structure analyses indicate significant differentiation among population units at the FST level, but not at the ΦST level. Significant differentiation at the FST level was found between the Caribbean population unit and all other populations units. These results suggest historical or present connectivity between the Azores and Madeira and the southeastern Brazil groups and population differentiation between the Caribbean and southeastern Brazil, supporting the notion of two separate stocks in the waters around the Atlantic coast of South America. © 2013 Elsevier Ltd.

Epidemiologia molecular e fatores de risco para aquisição de clones endêmicos de Staphylococcus aureus resistente à Meticilina (MRSA) em hospital de ensino

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Associações genéticas com o marcador alfa actina 1, e variabilidade genética de características de importância econômica de frangos de corte

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Selective DMSO-induced conformational changes in proteins from Raman optical activity

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Padronização de técnica manual para obtenção de plasma rico em plaquetas de bovino

To evaluate the biochemical profile and protein concentration of whey from milk samples of healthy Murrah primiparous and pluriparous buffaloes, 30 female buffaloes were analyzed during a complete lactation. The animals were divided into three groups: G1 = 10 primiparous buffaloes, G2 = 10 pluriparous buffaloes with 2-3 lactations and G3 = 10 pluriparous buffaloes with > 3 lactations. The lactation period was divided into: early stage (I: 1-3 months of lactation), intermediate stage (T: 4-6 months of lactation) and final stage (F: 7-9 months of lactation). Before milk sampling, physical examination of the mammary gland, strip cup test and California Mastitis Test (CMT) were performed. After mammary quarters asepsis, 20mL of milk were collected monthly from each mammary quarter, during a complete lactation, in sterilized plastic bottles without preservative, in order to perform microbiological isolation, biochemical profile and protein electrophoresis in sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and 30mL of milk from each mammary quarter were collect, in sterilized plastic bottles containing preservative bronopol to perform the somatic cell count (SCC). A total of 1,042 milk samples were collected from the experimental groups during lactation, of which 923 samples showed negative reaction to CMT and negative microbiological isolation and were selected to biochemical profile analysis and protein electrophoresis in SDS-PAGE. There were influence of parity order and stage of lactation in biochemical profile and protein concentration of healthy Murrah buffaloes'whey. Primiparous buffaloes (G1) showed higher gamma-glutamyltransferase (GGT: 2,346 U/L), alkaline phosphatase (ALP: 181 U/L), phosphorus (P; 56.6mg/dL), potassium (K; 32.0mg/dL) and alpha-lactalbumin (458mg/dL). Buffaloes with 2-3 lactations (G2) showed higher SCC (70,700 cells/mL) and higher concentrations of total protein (1.55g/dL), albumin (100mg/dL), magnesium (Mg; 8.80mg/dL), chlorides (Cl; 176mg/dL), iron (Fe; 10.7 mu g/dL), sodium (Na; 178mMol/L) and lactoferrin (59.5mg/dL). Bufalloes with > 3 lactations (G3) showed higher concentrations of total calcium (Ca; 41.8mg/dL), ionized calcium (iCa; 2.92mMol/L), immunoglobulin A (IgA; 1.32mg/dL), serum albumin (99.1mg/dL), immunoglobulin G (IgG; 49.7mg/dL) and beta-lactoglobulin (1,068mg/dL). During lactation it was observed increase in SCC, GGT, ALP, total protein, albumin, P, Mg, Cl, Na, lactoferrin, serum albumin, IgG and alpha-lactalbumin, as well as decrease in concentrations of Ca, Fe, iCa, K, IgA and beta-lactoglobulin in buffaloes'whey. The results may be used as reference for buffaloes and to support diagnosis and prognosis of diseases common to lactation periods.