Measuring root traits in barley (Hordeum vulgare ssp vulgare and ssp spontaneum) seedlings using gel chambers, soil sacs and X-ray microtomography

Root characteristics of seedlings of five different barley genotypes were analysed in 2D using gel chambers, and in 3D using soil sacs that were destructively harvested and pots of soil that were assessed non-invasively using X-ray microtomography. After 5 days, Chime produced the greatest number of root axes (similar to 6) and Mehola significantly less (similar to 4) in all growing methods. Total root length was longest in GSH01915 and shortest in Mehola for all methods, but both total length and average root diameter were significantly larger for plants grown in gel chambers than those grown in soil. The ranking of particular growth traits (root number, root angular spread) of plants grown in gel plates, soil sacs and X-ray pots was similar, but plants grown in the gel chambers had a different order of ranking for root length to the soil-grown plants. Analysis of angles in soil-grown plants showed that Tadmore had the most even spread of individual roots and Chime had a propensity for non-uniform distribution and root clumping. The roots of Mehola were less well spread than the barley cultivars supporting the suggestion that wild and landrace barleys tend to have a narrower angular spread than modern cultivars. The three dimensional analysis of root systems carried out in this study provides insights into the limitations of screening methods for root traits and useful data for modelling root architecture.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Fulvalene titanium and zirconium complexes: synthesis and NMR study of phosphanido-, alkyl-, and alkynyl-derivatives. X-ray crystal structures of [{Ti(η5−C5H5)(μ−PPH2)}2{μ−(η5−C5H4−η5−C5H4)}] and [{Zr(η5−C5H5)(μ−C≡CSiMe3)}2{μ−(η5−C5H4−η5−C5H4)}]

Reaction of with one or two equivalents of LiPPh2 afforded the new phosphanidometal(III) complexes . Reaction of 2 with LiC≡CSiMe3 led to the diamagnetic zirconium(III) alkynyl derivative [{Zr(C5H5)(μ−C≡CSiMe3)}2(μ−η5−C5H4−η5−C5H4], 7. Alkylation of 6 with LiCH2CMe2Ph gave [{Zr(η5−C5H5)(CH2CMe2Ph)2}2{μ−(η5−C5H4)}], 8. A detailed NMR study of complexes 3 and 4 allowed the observation of the spectral behaviour of the eight different fulvalene protons through their coupling to the 31P nucleus. The fluxional behaviour of complex 7 was studied by dynamic DNMR, and kinetic parameters for the σ-π-conversion of the alkynyl ligand were determined. The molecular structures of complexes 3 and 7 were determined by X-ray diffraction methods.

Application of cylindrical distribution functions to wide-angle X-ray scattering from oriented polymers

A systematic approach is presented for obtaining cylindrical distribution functions (CDF's) of noncrystalline polymers which have been oriented by extension. The scattering patterns and CDF's are also sharpened by the method proposed by Deas and by Ruland. Data from atactic poly(methyl methacrylate) and polystyrene are analysed by these techniques. The methods could also be usefully applied to liquid crystals.

Unraveling the electronic structures of low-valent naphthalene and anthracene iron complexes: x-ray, spectroscopic, and density functional theory studies

Naphthalene and anthracene transition metalates are potent reagents, but their electronic structures have remained poorly explored. A study of four Cp*-substituted iron complexes (Cp* = pentamethylcyclopentadienyl) now gives rare insight into the bonding features of such species. The highly oxygen- and water-sensitive compounds [K(18-crown- 6){Cp*Fe(η4-C10H8)}] (K1), [K(18-crown-6){Cp*Fe(η4-C14H10)}] (K2), [Cp*Fe(η4-C10H8)] (1), and [Cp*Fe(η4-C14H10)] (2) were synthesized and characterized by NMR, UV−vis, and 57Fe Mössbauer spectroscopy. The paramagnetic complexes 1 and 2 were additionally characterized by electron paramagnetic resonance (EPR) spectroscopy and magnetic susceptibility measurements. The molecular structures of complexes K1, K2, and 2 were determined by single-crystal X-ray crystallography. Cyclic voltammetry of 1 and 2 and spectroelectrochemical experiments revealed the redox properties of these complexes, which are reversibly reduced to the monoanions [Cp*Fe(η4-C10H8)]− (1−) and [Cp*Fe(η4-C14H10)]− (2−) and reversibly oxidized to the cations [Cp*Fe(η6-C10H8)]+ (1+) and [Cp*Fe(η6-C14H10)]+ (2+). Reduced orbital charges and spin densities of the naphthalene complexes 1−/0/+ and the anthracene derivatives 2−/0/+ were obtained by density functional theory (DFT) methods. Analysis of these data suggests that the electronic structures of the anions 1− and 2− are best represented by low-spin FeII ions coordinated by anionic Cp* and dianionic naphthalene and anthracene ligands. The electronic structures of the neutral complexes 1 and 2 may be described by a superposition of two resonance configurations which, on the one hand, involve a low-spin FeI ion coordinated by the neutral naphthalene or anthracene ligand L, and, on the other hand, a low-spin FeII ion coordinated to a ligand radical L•−. Our study thus reveals the redox noninnocent character of the naphthalene and anthracene ligands, which effectively stabilize the iron atoms in a low formal, but significantly higher spectroscopic oxidation state.

Peroxidative bromination and oxygenation of organic compounds: synthesis, X-ray crystal structure and catalytic implications of mononuclear and binuclear oxovanadium(V) complexes containing Schiffbase ligands

Treatment of of (R,R)-N,N-salicylidene cyclohexane 1,2-diamine(H(2)L(1)) in methanol with aqueous NH(4)VO(3) solution in perchloric acid medium affords the mononuclear oxovanadium(V) complex [VOL(1)(MeOH)]-ClO(4) (1) as deep blue solid while the treatment of same solution of (R,R)-N,N-salicylidene cyclohexane 1,2-diamine(H(2)L(1)) with aqueous solution of VOSO(4) leads to the formation of di-(mu-oxo) bridged vanadium(V) complex [VO(2)L(2)](2) (2) as green solid where HL(2) = (R,R)-N-salicylidene cyclohexane 1,2-diamine. The ligand HL(2) is generated in situ by the hydrolysis of one of the imine bonds of HL(1) ligand during the course of formation of complex [VO(2)L(2)](2) (2). Both the compounds have been characterized by single crystal X-ray diffraction as well as spectroscopic methods. Compounds 1 and 2 are to act as catalyst for the catalytic bromide oxidation and C-H bond oxidation in presence of hydrogen peroxide. The representative substrates 2,4-dimethoxy benzoic acid and para-hydroxy benzoic acids are brominated in presence of H(2)O(2) and KBr in acid medium using the above compounds as catalyst. The complexes are also used as catalyst for C-H bond activation of the representative hydrocarbons toluene, ethylbenzene and cyclohexane where hydrogen peroxide acts as terminal oxidant. The yield percentage and turnover number are also quite good for the above catalytic reaction. The oxidized products of hydrocarbons have been characterized by GC Analysis while the brominated products have been characterized by (1)H NMR spectroscopic studies.

Synthesis and spectroscopic properties of cobalt(III) complexes of some aroyl hydrazones: x-ray crystal structures of one cobalt(III) complex and two aroyl hydrazone ligands

Cobalt(III) complexes of diacetyl monooxime benzoyl hydrazone (dmoBH(2)) and diacetyl monooxime isonicotinoyl hydrazone (dmoInH(2)) have been synthesized and characterized by elemental analyses and spectroscopic methods. The X-ray crystal structures of the two hydrazone ligands, as well as that of the cobalt(III) complex [Co(III)(dmoInH)(2)]Cl center dot 2H(2)O, are also reported. It is found that in the cobalt(III) complexes the Co(III) ion is hexa-coordinated, the hydrazone ligands behaving as mono-anionic tridentate O,N,N donors. In the [Co(III)(dmoInH) (2)]Cl center dot 2H(2)O complex, the amide and the oxime hydrogens are deprotonated for both the ligands, while the isonicotine nitrogens are protonated. In the [Co(III)(d-moBH)(2)] Cl complex, only the amide nitrogens are deprotonated. It is shown that the additional hydrogen bonding capability of the isonicotine nitrogen results in different conformation and supramolecular structure for dmoInH(2), compared to dmoBH(2), in the solid state. Comparing the structure of the [CoIII(dmoInH)(2)]Cl center dot 2H(2)O with that of the Zn(II) complex of the same ligand, reported earlier, it is seen that the metal ion has a profound influence on the supramolecular structure, due to change in geometrical dispositions of the chelate rings.

Metal location and thickness in a multilayered sheet by measuring K alpha/K beta, L alpha/L beta and L alpha/L gamma X-ray ratios

When a multilayered material is analyzed by means of energy-dispersive X-ray fluorescence analysis, then the X-ray ratios of K alpha/K beta, or L alpha/L beta and L alpha/L gamma, for an element in the multilayered material, depend on the composition and thickness of the layer in which the element is situated, and on the composition and thickness of the superimposed layer (or layers). Multilayered samples are common in archaeometry, for example, in the case of pigment layers in paintings, or in the case of gilded or silvered alloys. The latter situation is examined in detail in the present paper, with a specific reference to pre-Columbian alloys from various museums in the north of Peru. (C) 2009 Elsevier B.V. All rights reserved.

Vibrational properties, crystal X-ray diffraction structure and quantum chemical calculations on a divalent sulfur substituted phthalimide: 1H-Isoindole-1,3(2H)-dione, 2-[(methoxycarbonyl)thio]

Structural and conformational properties of 1H-Isoindole-1,3(2H)-dione, 2-[(methoxycarbonyl)thio] (S-phthalimido O-methyl thiocarbonate) are analyzed using a combined approach including X-ray diffraction, vibrational spectra and theoretical calculation methods. The vibrational properties have been studied by infrared and Raman spectroscopies along with quantum chemical calculations (B3LYP and B3PW91 functional in connection with the 6-311++G** and aug-cc-pVDZ basis sets). The crystal structure was determined by X-ray diffraction methods. The substance crystallizes in the monoclinic P2(1)/c space group with a = 6.795(1), b = 5.109(1), c = 30.011(3) angstrom, beta = 90.310(3)degrees and Z = 4 molecules per unit cell. The conformation adopted by the N-S-C=O group is syn (C=O double bond in synperiplanar orientation with respect to the N-S single bond). The experimental molecular structure is well reproduced by the MP2/aug-cc-pVDZ method. (C) 2010 Elsevier B.V. All rights reserved.

Crystal and molecular structures of three 2-sulphur-substituted cyclohexanones studied by X-ray crystallography and by ab initio molecular orbital calculations

The conformational features of three 2-sulphur-substituted cyclohexanone derivatives, which differ in the number of sulphur-bound oxygen atoms, i.e. zero (I), one (II) and two (III), were investigated by single crystal X-ray crystallography and geometry optimized structures determined using Hartree-Fock method. In each of (I)-(III) an intramolecular S center dot center dot center dot O(carbonyl) interaction is found with the magnitude correlated with the oxidation state of the sulphur atom, i.e. 2.838(3) angstrom in (I) to 2.924(2) angstrom in (II) to 3.0973(18) angstrom in (III). There is an inverse relationship between the strength of this interaction and the magnitude of the carbonyl bond. The supramolecular aggregation patterns are primarily determined by C-H center dot center dot center dot O contacts and are similarly influenced by the number of oxygen atoms in the molecular structures. Thus, a supramolecular chain is found in the crystal structure of (I). With an additional oxygen atom available to participate in C-H center dot center dot center dot O interactions, as in (II), a two-dimensional array is found. Finally, a three-dimensional network is found for (III). Despite there being differences in conformations between the experimental structures and those calculated in the gas-phase, the S center dot center dot center dot O interactions persist. The presence of intermolecular C-H center dot center dot center dot O interactions involving the cyclohexanone-carbonyl group in the solid-state, disrupts the stabilising intramolecular C-H center dot center dot center dot O interaction in the energetically-favoured conformation. (I): C(12)H(13)NO(3)S, triclinic space group P (1) over bar with a = 5.392(3) angstrom b = 10.731(6) angstrom, c = 11.075(6) angstrom, alpha = 113.424(4)degrees, beta = 94.167(9)degrees, gamma = 98.444(6)degrees, V = 575.5(6) angstrom(3), Z = 2, R(1) = 0.052; (II): C(12)H(13)NO(4)S, monoclinic P2(1)/n, a = 7.3506(15) angstrom, b = 6.7814(14) angstrom, c = 23.479(5) angstrom, beta = 92.94(3)degrees, V = 1168.8(4) angstrom(3), Z = 4, R(1) = 0.046; (III): C(12)H(13)NO(5)S, monoclinic P2(1)/c, a = 5.5491(11) angstrom, b = 24.146(3) angstrom, c = 11.124(3) angstrom, beta = 114.590(10)degrees, V = 1355.3(5) angstrom(3), Z = 4, R(1) = 0.051.

Analysis of failed commercially pure titanium dental implants: A scanning electron microscopy and energy-dispersive spectrometer X-ray study

Background: the failure of osseointegration in oral rehabilitation has gained importance in current literature and in clinical practice. The integration of titanium dental implants in alveolar bone has been partly ascribed to the biocompatibility of the implant surface oxide layer. The aim of this investigation was to analyze the surface topography and composition of failed titanium dental implants in order to determine possible causes of failure.Methods: Twenty-one commercially pure titanium (cpTi) implants were retrieved from 16 patients (mean age of 50.33 +/- 11.81 years). Fourteen implants were retrieved before loading (early failures), six after loading (late failures), and one because of mandibular canal damage. The failure criterion was lack of osseointegration characterized as dental implant mobility. Two unused implants were used as a control group. All implant surfaces were examined by scanning electron microscopy (SEM) and energy-dispersive spectrometer x-ray (EDS) to element analysis. Evaluations were performed on several locations of the same implant.Results: SEM showed that the surface of all retrieved implants consisted of different degrees of organic residues, appearing mainly as dark stains. The surface topography presented as grooves and ridges along the machined surface similar to control group. Overall, foreign elements such as carbon, oxygen, sodium, calcium, silicon, and aluminum were detected in failed implants. The implants from control group presented no macroscopic contamination and clear signs of titanium.Conclusion: These preliminary results do not suggest any material-related cause for implant failures, although different element composition was assessed between failed implants and control implants.

Crystallization and preliminary X-ray analysis of bucain, a novel toxin from the Malayan krait Bungarus candidus

Bucain is a three-finger toxin, structurally homologous to snake-venom muscarinic toxins, from the venom of the Malayan krait Bungarus candidus. These proteins have molecular masses of approximately 6000-8000 da and encompass the potent curaremimetic neurotoxins which confer lethality to Elapidae and Hydrophidae venoms. Bucain was crystallized in two crystal forms by the hanging-drop vapour-diffusion technique in 0.1 M sodium citrate pH 5.6, 15% PEG 4000 and 0.15 M ammonium acetate. Form I crystals belong to the monoclinic system space group C2, with unit-cell parameters a = 93.73, b = 49.02, c = 74.09 Angstrom, beta = 111.32degrees, and diffract to a nominal resolution of 1.61 Angstrom. Form II crystals also belong to the space group C2, with unit-cell parameters a = 165.04, b = 49.44, c = 127.60 Angstrom, beta = 125.55degrees, and diffract to a nominal resolution of 2.78 Angstrom. The self-rotation function indicates the presence of four and eight molecules in the crystallographic asymmetric unit of the form I and form II crystals, respectively. Attempts to solve these structures by molecular-replacement methods have not been successful and a heavy-atom derivative search has been initiated.

Structural and optical properties of GdAlO3:RE3+ (RE = Eu or Tb) prepared by the Pechini method for application as X-ray phosphors

In this work, GdAlO3:RE3+ (RE = Eu or Tb) was successfully prepared by the Pechini method at lower temperatures when compared to others methods as solid-state synthesis and sol-gel process. In accordance to the XRD data, the fully crystalline single-phase GdAlO3 could be obtained at 900 degrees C. The differential thermal analysis (DTA) shows a crystallization peak at 850 degrees C. The samples are composed by monocrystalline particles (50-120 nm) exhibiting the formation of aggregates among them, which indicates the beginning of the sinterization process. This feature indicates a strong tendency to the formation of aggregates, which is a suitable ability for the close-packing of particles, and hence a potential application in X-ray intensifying screens. Luminescence measurements indicate Gd3+ -> RE3+ energy transfer. The Eu3+ emission spectra exhibit all the characteristics D-5(0) -> F-7(j) transitions and the observed profile suggests that RE3+ ions occupy at least one site without center of symmetry. For terbium-doped samples, the D-5(3) -> F-7(j) (blue emission) and D-5(4) -> F-7(j) (green emission) transitions were observed and the ratio between them may depend on the Tb3+ content due to cross-relaxation processes. (C) 2009 Elsevier B.V. All rights reserved.

Seed weight of Xylopia aromatica (Annonaceae): quality evaluation from X-ray and seedling emergence

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Crystallization and preliminary X-ray diffraction analysis of XAC1151, a small heat-shock protein from Xanthomonas axonopodis pv. citri belonging to the alpha-crystallin family

The hspA gene (XAC1151) from Xanthomonas axonopodis pv. citri encodes a protein of 158 amino acids that belongs to the small heat-shock protein ( sHSP) family of proteins. These proteins function as molecular chaperones by preventing protein aggregation. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium phosphate. X-ray diffraction data were collected to 1.65 angstrom resolution using a synchrotron-radiation source. The crystal belongs to the rhombohedral space group R3, with unit-cell parameters a = b = 128.7, c = 55.3 angstrom. The crystal structure was solved by molecular-replacement methods. Structure refinement is in progress.