The effects of cocoa on the immune system

Cocoa is a food relatively rich in polyphenols, which makes it a potent antioxidant. Due to its activity as an antioxidant, as well as through other mechanisms, cocoa consumption has been reported to be beneficial for cardiovascular health, brain functions, and cancer prevention. Furthermore, cocoa influences the immune system, in particular the inflammatory innate response and the systemic and intestinal adaptive immune response. Preclinical studies have demonstrated that a cocoa-enriched diet modifies T-cell functions that conduce to a modulation of the synthesis of systemic and gut antibodies. In this regard, it seems that a cocoa diet in rats produces changes in the lymphocyte composition of secondary lymphoid tissues and the cytokines secreted by T cells. These results suggest that it is possible that cocoa could inhibit the function of Th2 cells, and in line with this, the preventive effect of cocoa on IgE synthesis in a rat allergy model has been reported, which opens up new perspectives when considering the beneficial effects of cocoa compounds. On the other hand, cocoa intake modifies the functionality of gut-associated lymphoid tissue by means of modulating IgA secretion and intestinal microbiota. The mechanisms involved in these influences are discussed here. Further research may elucidate the cocoa compounds involved in such an effect and also the possible medical approaches to these repercussions

Quantitative proteomics in the characterization of T helper lymphocyte differentiation

The term proteome is used to define the complete set of proteins expressed in cells or tissues of an organism at a certain timepoint. Respectively, proteomics is used to describe the methods, which are used to study such proteomes. These methods include chromatographic and electrophoretic techniques for protein or peptide fractionation, mass spectrometry for their identification, and use of computational methods to assist the complicated data analysis. A primary aim in this Ph.D. thesis was to set-up, optimize, and develop proteomics methods for analysing proteins extracted from T-helper (Th) lymphocytes. First, high-throughput LC-MS/MS and ICAT labeling methods were set-up and optimized for analysing the microsomal fraction proteins extracted from Th lymphocytes. Later, iTRAQ method was optimized to study cytokine regulated protein expression in the nuclei of Th lymphocytes. High-throughput LC-MS/MS analyses, like ICAT and iTRAQ, produce large quantities of data and robust software and data analysis pipelines are needed. Therefore, different software programs used for analysing such data were evaluated. Moreover, a pre-filtering algorithm was developed to classify good-quality and bad-quality spectra prior to the database searches. Th-lymphocytes can differentiate into Th1 or Th2 cells based on surrounding antigens, co-stimulatory molecules, and cytokines. Both subsets have individual cytokine secretion profiles and specific functions. Th1 cells participate in the cellular immunity against intracellular pathogens, while Th2 cells have important role in the humoral immunity against extracellular parasites. An abnormal response of Th1 and Th2 cells and imbalance between the subsets are charasteristic of several diseases. Th1 specific reactions and cytokines have been detected in autoimmune diseases, while Th2 specific response and cytokine profile is common in allergy and asthma. In this Ph. D. thesis mass spectrometry-based proteomics was used to study the effects of Th1 and Th2 promoting cytokines IL-12 and IL-4 on the proteome of Th lymphocytes. Characterization of microsomal fraction proteome extracted from IL-12 treated lymphobasts and IL-4 stimulated cord blood CD4+ cells resulted in finding of cytokine regulated proteins. Galectin-1 and CD7 were down-regulated in IL-12 treated cells, while IL-4 stimulation decreased the expression of STAT1, MXA, GIMAP1, and GIMAP4. Interestingly, the transcription of both GIMAP genes was up-regulated in Th1 polarized cells and down-regulated in Th2 promoting conditions.

Interleukin-4 induced leukocyte differentiation

Monocytes, macrophages and dendritic cells (DCs) are important mediators of innate immune system, whereas T lymphocytes are the effector cells of adaptive immune responses. DCs play a crucial role in bridging innate and adaptive immunity. Naïve CD4+ Th progenitors (Thp) differentiate to functionally distinct effector T cell subsets including Th1, Th2 and Th17 cells, which while being responsible for specific immune functions have also been implicated in pathological responses, such as autoimmunity, asthma and allergy. The main objective of this thesis is to dissect the signalling networks involved in the IL-4 induced differentiation of two important leukocyte subtypes, Th2 cells and DCs. Gene expression profiling lead to identification of over 200 genes which are differentially expressed during cytokine induced differentiation of human monocytes to DCs or macrophages and which are likely to be essential for the proper biological functions of these cell types. Transcriptome analysis demonstrated the dynamic regulation of gene expression by IL-12 and IL-4 during the initiation of Th cell differentiation, which was partly counteracted by an immunosuppressive cytokine, TGFβ, present in the culture media. Results from RNAi mediated gene knockdown experiments and global gene expression analysis elucidated that SATB1 regulates multiple genes important for Th cell polarization or function as well as may compete with GATA3 for the reciprocal regulation of IL-5 transcription. In conclusion, the results obtained have extended our system-level understanding of the immune cell differentiation processes and provide an excellent basis for the further functional studies which could lead to development of improved therapeutic approaches for a range of immunological conditions.

Regulation of lymphocyte response in vitro and in vivo

CD4+ T helper (Th) cells have an important role in the defence against diverse pathogens. Th cells can differentiate into several functionally distinct subtypes including Th1 and Th2 cells. Th1 cells are important for eradicating intracellular pathogens, whereas Th2 cells pro¬tect our body against extracellular parasites. However if uncontrolled, Th cells can mediate immunopathology such as asthma or allergies, but inappropriate Th response can also lead to autoimmune diseases such as multiple sclerosis or type 1 diabetes. Deeper knowledge of the regulation of the lymphocyte response both in vitro and in vivo is important for un¬derstanding the pathogenesis of immune-mediated diseases and microbe-host interactions. In the work presented in this thesis, the first goal was to elucidate the role of novel factors, PIM kinases and c-FLIP in the regulation of human Th cell differentiation. The oncogenic serine-threonine kinases of the PIM family were shown to be preferentially expressed in Th1 cells and in addition, by using RNA interference, they were also shown to be positive regulators of Th1 differentiation. The PIM depletion experiments suggest that PIM kinases promote the expression of the hallmark cytokine of Th1 cells, IFNγ, and influence the IL12/STAT4 pathway during the early Th1 cell differentiation. In addition to cytokine and T cell receptor (TCR) induced pathways, caspase activity has been shown to regulate Th cell proliferation. In the work presented in this thesis, the two isoforms of the caspase regulator protein, c-FLIP, were shown to be differentially ex¬pressed in Th1 and Th2 cells. Both of the isoforms were up-regulated in response to TCR activation, but the expression of the short isoform was selectively induced by IL4, the Th2 inducing cytokine. Furthermore, the c-FLIP isoforms had distinct and opposite roles during the early differentiation of Th1 and Th2 cells. The knockdown of the long isoform of c-FLIP led to the induction of Th1 marker genes, such as IFNγ and TBET, whereas the depletion of c-FLIP short down-regulated Th2 marker genes IL-4 and GATA3. The third goal was to elucidate the gene expression profiles characterizing the T- and B-lymphocyte responses in vivo during experimental infection by intracellular bacte¬rium Chlamydia pneumoniae. Previously, it has been shown that CD8+ and CD4+ T cells are important for the protection against Chlamydia pneumoniae. In this study, the analysis revealed up-regulation of interferon induced genes during recurrent infection underlining the importance of IFNγ secreted by Th1 and CD8+ T cells in the protection against this pathogen. Taken together, in this study novel regulators of Th cell differ¬entiation were discovered and in addition the gene expression profiles of lymphocytes induced by Chlamydia pneumoniae infection were characterized.

Cytokines as determinants of disease and disease interactions

The immune response to pathogens results in both host resistance and immunopathology. Cytokines and in particular those lymphokines produced by Th1 and Th2 cells play a key role in determining the balance between these two immunologic outcomes. Recent data suggest that interleukin-10, a product of both Th2 cells and macrophages, protects the host against excessive immunopathology. The cytokine environment generated by different pathogens may also influence the course and outcome of infections with unrelated organisms. This relationship may be particularly important in the case of HIV-1 where prior Th1 or Th2 biases established by helminth or intracellular infections may influence either initial viral susceptibility or drive progression to AIDS through immune activation

Detection of specific IgE antibodies in parasite diseases

Activation of Th1 or Th2 cells is associated with production of specific immunoglobulin isotypes, offering the opportunity to use antibody measurement for evaluation of T cell function. Schistosomiasis and visceral leishmaniasis are diseases associated with Th2 activation. However, an IgE response is not always detected in these patients. In the present study we evaluated specific IgE antibodies to S. mansoni and L. chagasi antigens by ELISA after depletion of serum IgG with protein G immobilized on Sepharose beads or RF-absorbent (purified sheep IgG antibodies anti-human IgG). In schistosomiasis patients, specific IgE to SWAP antigen was demonstrable in only 10 of 21 patients (48%) (mean absorbance ± SD = 0.102 ± 0.195) when unabsorbed serum was used. Depletion of IgG with protein G increased the number of specific IgE-positive tests to 13 (62%) and the use of RF-absorbent increased the number of positive results to 20 (95%) (mean absorbances ± SD = 0.303 ± 0.455 and 0.374 ± 0.477, respectively). Specific IgE anti-L. chagasi antibodies were not detected in unabsorbed serum from visceral leishmaniasis patients. When IgG was depleted with protein G, IgE antibodies were detected in only 3 (11%) of 27 patients, and the use of RF-absorbent permitted the detection of this isotype in all 27 visceral leishmaniasis sera tested (mean absorbance ± SD = 0.104 ± 0.03). These data show that the presence of IgG antibodies may prevent the detection of a specific IgE response in these parasite diseases. RF-absorbent, a reagent that blocks IgG-binding sites and also removes rheumatoid factor, was more efficient than protein G for the demonstration of specific IgE antibodies.

Immunity and immunosuppression in experimental visceral leishmaniasis

Leishmaniasis is a disease caused by protozoa of the genus Leishmania, and visceral leishmaniasis is a form in which the inner organs are affected. Since knowledge about immunity in experimental visceral leishmaniasis is poor, we present here a review on immunity and immunosuppression in experimental visceral leishmaniasis in mouse and hamster models. We show the complexity of the mechanisms involved and differences when compared with the cutaneous form of leishmaniasis. Resistance in visceral leishmaniasis involves both CD4+ and CD8+ T cells, and interleukin (IL)-2, interferon (IFN)- gamma, and IL-12, the latter in a mechanism independent of IFN- gamma and linked to transforming growth factor (TGF)-ß production. Susceptibility involves IL-10 but not IL-4, and B cells. In immune animals, upon re-infection, the elements involved in resistance are different, i.e., CD8+ T cells and IL-2. Since one of the immunopathological consequences of active visceral leishmaniasis in humans is suppression of T-cell responses, many studies have been conducted using experimental models. Immunosuppression is mainly Leishmania antigen specific, and T cells, Th2 cells and adherent antigen-presenting cells have been shown to be involved. Interactions of the co-stimulatory molecule family B7-CTLA-4 leading to increased level of TGF-ß as well as apoptosis of CD4+ T cells and inhibition of macrophage apoptosis by Leishmania infection are other components participating in immunosuppression. A better understanding of this complex immune response and the mechanisms of immunosuppression in experimental visceral leishmaniasis will contribute to the study of human disease and to vaccine development.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Follicular helper T cell in immunity and autoimmunity

The traditional concept that effector T helper (Th) responses are mediated by Th1/Th2 cell subtypes has been broadened by the recent demonstration of two new effector T helper cells, the IL-17 producing cells (Th17) and the follicular helper T cells (Tfh). These new subsets have many features in common, such as the ability to produce IL-21 and to express the IL-23 receptor (IL23R), the inducible co-stimulatory molecule ICOS, and the transcription factor c-Maf, all of them essential for expansion and establishment of the final pool of both subsets. Tfh cells differ from Th17 by their ability to home to B cell areas in secondary lymphoid tissue through interactions mediated by the chemokine receptor CXCR5 and its ligand CXCL13. These CXCR5+ CD4+ T cells are considered an effector T cell type specialized in B cell help, with a transcriptional profile distinct from Th1 and Th2 cells. The role of Tfh cells and its primary product, IL-21, on B-cell activation and differentiation is essential for humoral immunity against infectious agents. However, when deregulated, Tfh cells could represent an important mechanism contributing to exacerbated humoral response and autoantibody production in autoimmune diseases. This review highlights the importance of Tfh cells by focusing on their biology and differentiation processes in the context of normal immune response to infectious microorganisms and their role in the pathogenesis of autoimmune diseases.

Rôle de la voie PGD2/L-PGDS dans la physiopathologie de l’arthrose

L’arthrose (OA) est la maladie articulaire la plus répandue dans le monde faisant l’objet de nombreux travaux de recherche en raison de son lourd impact socioéconomique. Plusieurs travaux dans ce domaine ont pour objectif de déterminer les mécanismes moléculaires impliqués dans sa physiopathologie. Plusieurs travaux ont appuyés l’implication de la prostaglandine (E2) PGE2 dans sa physiopathologie, contrairement à la prostaglandine (D2) (PGD2) dont le rôle reste à déterminer. C’est pourquoi, nous nous sommes penchés dans cette thèse à l’étude de cette dernière molécule. Dans la première partie de nos travaux, nous avons montré que la PGD2 diminue au niveau du cartilage articulaire et au niveau niveau des explants de cartilage humains, la production des métalloprotéases-1(MMP-1) et MMP-13 induites par (Interleukine-1β) l’IL-1β. Cette diminution de la production protéique est accompagnée d’une diminution de l’expression au niveau de l’ARNm, et d’une diminution de l’activité du promoteur de MMP-1 et MMP-13. Cet effet est exercé via le récepteur D prostanoïde (DP1), bien que le Chemoattractant receptor expressed on Th2 cells (CRTH2) soit également exprimé chez les chondrocytes humains, mais ne semble pas être impliqué dans l’effet observé. Cette action inhibitrice se fait via la voie DP1/AMPc/protéine kinase A (AMPc/PKA). Dans la suite de nos travaux, nous avons montré pour la première fois l’expression des prostaglandines D-synthases responsables de la biosynthèse de la PGD2 au niveau des chondrocytes humains par immunohistochimie, avec des niveaux d’expression de l’ARNm plus élevés de la L-PGDS au niveau du cartilage OA comparativement au cartilage normal. L’IL-1β pourrait être responsable de cette augmentation via l’activation de la voie JNK et p38 MAPK, ainsi que par la voie NF-κB. L’ensemble de ces données indiquent que la modulation des niveaux de la PGD2 au niveau de l’articulation pourrait être pourvue d’un important potentiel thérapeutique. La L-PGDS pour sa part semble avoir un rôle important dans la physiopathologie de l’OA.

Antibody and cytokine serum levels in patients subjected to anti-rabies prophylaxis with serum-vaccination

Rabies is considered a fatal disease once clinical symptoms have developed. The aim of this study was to evaluate epidemiological aspects and immune response in patients attacked by domestic and wild animals and subjected to post-exposure rabies treatment with equine serum and associated vaccine. Thirty-three patients were evaluated; they were between 13 and 65 years old, 75.8% were male and 24.2% female, and from the Botucatu neighborhood. Twenty healthy control individuals with the same age range were also studied. Specific antibodies to equine immunoglobulins and IFN-γ, IL-2, IL-4, and IL-10 production were evaluated by ELISA. IgM, IgE, IgG and subclasses, and rabies virus antibodies serum levels were determined by nephelometry and seroneutralization methods, respectively. No anaphylactic or serum sickness allergic reactions were observed in patients after treatment. Anti-equine IgG levels were significantly higher than those of IgM after 14 and 28 days of treatment. Protective antibodies to rabies virus > 0.5 UI/ml were detected in 84.6% and 75% of patients at days 14 and 28, respectively. IFN-γ, IL-2 and IL-10 levels in patients before and 48h after treatment were significantly higher than in controls suggesting that both Th1 and Th2 cells were activated in the patients. Serum IgM levels were higher at day 14, and IgG 2 and IgE levels were higher at day 28 of treatment. These results suggest that post-exposure rabies treatment in humans induces significant alterations in patient immune response characterized by increased levels of cytokines, serum levels of specific rabies virus antibodies, and the equine serum components employed in the treatment.

Previous contact with Strongyloides venezuelensis contributed to prevent insulitis in MLD-STZ diabetes

Epidemiological and experimental studies support the idea that helminth infections can induce a protective effect against the development of autoimmune and allergic diseases. In this study we characterized the immune response induced by Strongyloides venezuelensis infection in C57BL/6 mice and then evaluated the effect of a previous contact with this helminth in the outcome of type 1 diabetes. Animals were initially infected with 2000 L3 larvae from S. venezuelensis and euthanized 22. days later. An acute phase, identified by a high amount of eggs per gram of feces, was established between days 7 and 9 post-infection. Recovery from infection was associated with a Th2 polarized response characterized by a significant level of serum IgG1 specific antibodies and also a significant production of IL-5 and IL-10 by spleen cells stimulated with S. venezuelensis soluble antigen. Immunization with soluble S. venezuelensis antigen associated with complete Freund's adjuvant followed by infection with S. venezuelensis protected mice from diabetes development induced by streptozotocin. Protection was characterized by a higher body weight gain, lower glycemic levels, much less severe insulitis and preserved insulin production. Together, these results indicate that S. venezuelensis contributed to protect C57BL/6 mice against experimental diabetes induced by streptozotocin. © 2013 Elsevier Inc.

IL-2, IL-5, TNF-α and IFN-γ mRNA expression in epidermal keratinocytes of systemic lupus erythematosus skin lesions

OBJECTIVE: To analyze cytokine gene expression in keratinocytes from patients with systemic lupus erythematosus (SLE). INTRODUCTION: Keratinocytes represent 95% of epidermal cells and can secrete several cytokines. METHODS: Keratinocytes were obtained by laser microdissection from 21 patients with SLE (10 discoid and 11 acute lesions) at involved and uninvolved sites. All patients were receiving a low/moderate prednisone dose and 18 were receiving chloroquine diphosphate. IL-2, IL-5, TNF-α and IFN-γ gene expression was evaluated by real-time PCR and expressed as the ratio (R) to a pool of skin samples from 12 healthy volunteers. RESULTS: Heterogeneity in cytokine gene expression was found among patients with SLE. Eighteen of 38 valid SLE samples (47%) presented overexpression (R>1) of at least one cytokine. Lesional skin samples tended to show higher cytokine expression than samples from uninvolved skin (p = 0.06). IL-5 and IFN-γ were the most commonly overexpressed cytokines. Samples with cytokine overexpression corresponded to more extensive and severe lesions. Prednisone dose did not differ between samples without cytokine overexpression (15.71±3.45 mg/day) and those with overexpressed cytokines (12.68±5.41 mg/day) (p = 0.216). Samples from all patients not receiving diphosphate chloroquine had at least one overexpressed cytokine. CONCLUSIONS: The heterogeneous keratinocyte cytokine gene expression reflects the complex immunological and inflammatory background in SLE. Patients with severe/extensive skin lesions showed a higher frequency of cytokine gene overexpression. Increased IFN-γ and IL-5 expression suggests that Th1 and Th2 cells are involved in SLE skin inflammation. The possibility that prednisone and antimalarial drugs may have contributed to low cytokine gene expression in some samples cannot be ruled out.

Quantificação de citocinas no conteúdo abomasal de bovinos de corte na presença ou ausência de ulceração gástrica

Pós-graduação em Ciência Animal - FMVA

Molekulare Reaktionsmuster in dendritischen Zellen nach Allergenexposition

Allergische Erkrankungen, wie zum Beispiel die allergische Rhinitis oder das allergische Asthma haben im Verlauf der letzten vier Jahrzehnte stark zugenommen. So leidet heute jeder vierte bis fünfte Mensch an einer Allergie. Ausgelöst wird diese IgE-vermittelte Hypersensibilitätsreaktion des Typs I (Allergie vom Soforttyp) von Allergenen und beruht auf der Aktivierung von Mastzellen durch die Interaktion eines Antigens mit dem an eine Mastzelle über die Fc-Rezeptoren gebundenen IgE-Moleküls. Die degranulierende Mastzelle sezerniert Mediatoren, was zu einem Auftreten von allergischen Symptomen führt. Die Bildung von IgE wird durch das von TH2-Zellen produzierte Zytokin IL-4 induziert. Das von TH1-Zellen produzierte Zytokin IFN- ist in der Lage die Sekretion von IL-4 zu inhibieren, wie auch IL-4 hemmend auf die Produktion von IFN- wirkt. Dieses TH1-/ TH2-Gleichgewicht ist bei allergischen Erkrankungen in Richtung TH2 verschoben. Allergene werden von antigenpräsentierenden Zellen aufgenommen, prozessiert und auf der Zelloberfläche präsentiert. Die potentesten antigenpräsentierenden Zellen sind die dendritischen Zellen, die nach Kontakt mit einem Allergen in die benachbarten Lymphknoten wandern, ausreifen und kostimulatorische Moleküle exprimieren. Sie sind so in der Lage T-Zellen zu aktivieren und entweder in TH1- oder in TH2-Zellen differenzieren zu lassen. Die zytokinabhängige TH1- beziehungsweise TH2-Differenzierung führt zur Aktivierung der Januskinasen. Im aktiven Zustand phosphorylieren sie STAT-Moleküle, die dimerisieren und in den Zellkern translozieren, wo sie unter anderem als Transkriptionsfaktoren für Zytokingene dienen. Unreife humane dendritische Zellen von Allergikern zeigen nach Stimulation mit Proteinallergenen eine schnelle Phosphorylierung des mit der TH2-Entwicklung assoziierten STAT6. Dahingegen sind TH1-Antwort hervorrufende Kontaktallergene nicht in der Lage STAT6 oder andere STAT-Moleküle in dendritischen Zellen zu induzieren. Die Transkriptionsfaktoren T-bet und GATA3 sind ebenfalls von Bedeutung für die TH1-/TH2-Entwicklung, da T-bet ausschließlich in TH1-Zellen, GATA3 nur in TH2-Zellen exprimiert wird. Die Regulation des JAK/STAT-Weg unterliegt den Molekülen der intrazellulär vorkommenden Familie der SOCS-Proteine. SOCS3 ist in TH2-Zellen höher exprimiert als SOCS1, wohingegen SOCS1 in TH1-Zellen eine erhöhte Expression gegenüber SOCS3 aufweist. In der vorliegenden Arbeit wurde der Einfluss von Proteinallergenen auf humane dendritische Zellen untersucht. Zunächst konnte eine morphologische Veränderung der unreifen dendritischen Zellen nach Kontakt mit dem Allergenextrakt beobachtet werden. Die beginnende Ausreifung der Zellen konnte mittels Durchflußzytometrie anhand der kostimulatorischen Moleküle CD80 und CD86, insbesondere aber über den Marker für reife dendritische Zellen CD83, nachgewiesen werden. Die zu beobachtende beginnende Ausreifung scheint ein Effekt des bakteriellen Lipopolysaccharids (LPS) zu sein, das in dem Allergenextrakt vorkommt, da sich durch Zugabe des kationischen Antibiotikums Polymyxin B die beginnende Reifung verhindern ließ. Auf RNA-Ebene war es im Rahmen dieser Arbeit möglich, den Einfluss verschiedener Allergene auf unreifen humanen dendritischen Zellen näher zu charakterisieren. So weisen unreife humane dendritische Zellen nach Kontakt mit Proteinallergenextrakt ein TH2-assoziiertes Genexpressionprofil auf, was sich durch eine erhöhte relative Expression der Gene SOCS3 und GATA3 auszeichnet. Im Gegensatz hierzu zeigen unreife humane dendritische Zellen nach Inkubation mit dem Kontaktallergen MCI/MI eine erhöhte relative Expression des Gens T-bet, was mit einer TH1-Antwort assoziiert ist. Nach Zugabe des „TH1-/ TH2-neutralen“ Tetanustoxoids konnten erhöhte relative Expressionen der Gene GATA3, T-bet und SOCS3 gemessen werden. Die Ergebnisse in dem in dieser Arbeit benutzten humanen in vitro System geben Anlass zur Hypothese, dass die Art der Immunantwort (TH1 versus TH2) sich bereits auf Ebene der dendritischen Zellen anbahnt. GeneChip-Analysen mittels High Density Micro Arrays von unreifen humanen dendritischen Zellen, die entweder mit Proteinallergenextrakt oder mit LPS in Berührung kamen, zeigten statistisch signifikant regulierte Gene, die allerdings keine Gemeinsamkeiten aufwiesen. Es konnten für die mit Alllergenextrakt gepulsten dendritischen Zellen insgesamt 10 Gene identifiziert werden, jedoch gelang es nicht, diese näher zu deuten oder in einen Zusammenhang mit der allergischen Erkrankung oder der dendritischen Zelle zu bringen. Für die mit LPS, dem stärkeren Stimulus, gepulsten dendritischen Zellen konnten 40 Gene identifiziert werden, die unter anderem für die Maturierung der dendritischen Zelle verantwortlich sind. Zudem war es möglich, die Daten der Arrays auf Proteinebene exemplarisch anhand des Chemokins CXCL2 (Gro-β) zu verifizieren.