Nest site selection by a neotropical swarm-founding wasp: seasonal alternation of nest orientation

Nest orientation in social insects has been intensively studied in warmer and cooler climates, particularly in the northern hemisphere. Previous studies have consistently shown that species subjected to these climatic conditions prefer to select mostly southern locations where the nests can gain direct sunlight. However, very little is known on nest orientation in tropical and subtropical social insects. We studied nest orientations initiated by swarms throughout a year in a Brazilian swarm-founding wasp, Polybia paulista von Ihering (Hymenoptera: Polistinae). Swarms selected various orientations as nest sites, but there was a particular trend in that swarms in the winter period (May-August) preferred to build northward-facing nests. This preference is opposite from that of social wasps observed in the northern hemisphere. Colonies of this species can potentially last for many years with continuous nesting, but nesting activities of colonies during the winter are severely limited due to cool temperature and a shortened day length. Northward-facing nests are warmer through the gain of direct solar heat during the winter period; consequently, choosing northward-facing sites may be advantageous for swarms in terms of a shortened brood development and shortened time needed to increase metabolic rates during warm-up for flight.

Variation of Patterns of Malocclusion by Site of Pharyngeal Obstruction in Children

Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

The uncharged surface features surrounding the active site of Escherichia coli DsbA are conserved and are implicated in peptide binding

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

The structure of versutoxin (delta-atracotoxin-Hv1) provides insights into the binding of site 3 neurotoxins to the voltage-gated sodium channel

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.

Influence of Suture on Peripheral Nerve Regeneration and Collagen Production at the Site of Neurorrhaphy: An Experimental Study

BACKGROUND: Restoration of nerve continuity and effective maintenance of coaptation are considered fundamental principles of end-to-end peripheral nerve repair. OBJECTIVE: To evaluate the influence of the number of stitches on axonal regeneration and collagen production after neurorrhaphy. METHODS: Thirty male Wistar rats were equally divided into 3 groups and were all operated on with the right sciatic nerve exposed. In 2 groups, the nerve was sectioned and repaired by means of 3 (group B) or 6 (group C) epineurium sutures with 100 monofilament nylon. One group (group A) was used as a control. Each animal from groups B and C underwent electrophysiological evaluation with motor action potential recordings before nerve section and again at an 8-week interval after neurorrhaphy. Nerve biopsy specimens were used for histomorphometric assessment of axonal regeneration and quantification of collagen at the repair site. RESULTS: Animals from group C had significantly lower motor action potential conduction velocities compared with control animals (P = .02), and no significant difference was seen between groups B and C. Parameters obtained from morphometric evaluation were not significantly different between these 2 groups. Type I collagen and III collagen in the epineurium were significantly higher in group C than in either the control group (P = .001 and P = .003) or group B (P = .01 and P = .02). No differences were identified for collagen I and III in the endoneurium. CONCLUSION: Using 6 sutures for nerve repair is associated with worse electrophysiological outcomes and higher amounts of type I and III collagen in the epineurium compared with control. Neurorraphy with 6 stitches is also related to a significant increase in epineurium collagen I and III compared with 3-stitch neurorraphy.

The outer wall of small airways is a major site of remodeling in fatal asthma

Background: Structural and inflammatory changes in asthma involve both the large and small airways, with involvement of the distal lung being related to disease severity. We have previously shown that changes in the extracellular matrix (ECM) composition of the distal lung are associated with loss of alveolar attachments in patients with fatal asthma. However, major ECM elements, such as collagen I and fibronectin and their regulators, have not been addressed at the distal level. Objective: We sought to evaluate ECM remodeling in the distal lungs of asthmatic patients. Methods: Using immunohistochemistry and image analysis, we determined the content of collagen I and III, fibronectin, and matrix metalloproteinases; (MMPs) 1, 2, and 9 and tissue inhibitors of metalloproteinase (MMPs) 1 and 2 in the large and small airways and lung parenchyma of 24 patients with fatal asthma and compared the results with those of 11 nonasthmatic control subjects. Protein content was defined as the area of positive staining divided by basement membrane or septum length. Results: We observed increased collagen I and decreased collagen III content in the small airways of asthmatic patients compared with that seen in control subjects. Greater fibronectin and MMP-1, MMP-2, and MMP-9 content was observed at the outer area of the small airways in asthmatic patients. NIMP content was also increased in the peribronchiolar parenchyma in asthmatic patients. In contrast, TIMP expression was only increased in the large airways of asthmatic patients compared with that seen in control subjects. Conclusions: The outer area of the small airways is a major site of ECM remodeling in fatal asthma, potentially contributing to functional changes and the loss of airway-parenchyma interdependence observed in patients with fatal asthma. (J Allergy Clin Immunol 2009;123:1090-7.)

COL1A1 Sp1-binding site polymorphism as a risk factor for genital prolapse

The objective of this study was to verify the possible association between the Sp1-binding site polymorphism and genital prolapse. A case-control study was conducted in 107 patients with stages III and IV genital prolapse. The control group included 209 women with stages 0 and I. The polymorphism of type I collagen Sp1-binding site was identified by amplification of the first intron of the COL1A1 gene. We did not find differences in the prevalence of the GT and TT genotypes between the groups (p=0.34), even when we grouped patients with at least one polymorphic allele (GT and TT) and compared them with patients without the polymorphic allele (GG; p=0.17) The presence of at least one vaginal delivery, family history for prolapse, and macrosomatic fetus were independent risk factors for prolapse. In conclusion, the COL1A1 Sp1-binding site was not significantly associated with genital prolapse among our study subjects.

Absence of pathological scarring in the donor site of the scalp in burns: An analysis of 295 cases

Aim: This study aims to describe the incidence of complications on scalp from which a thin split-skin graft was harvested (0.005-0.007 in.) of the donor site in children and adult burn victims. Methods: We reviewed the medical records of 295 burn patients admitted in the Burn Unit of the Clinical Hospital of the Faculty of Medicine of Ribeirao Preto, from January 1998 to December 2007, whose scalps were used as donor site for grafts. Skin-graft thickness varied from 0.005 in. to 0.007 in. The occurrence of pathological healing was evaluated clinically and the time of epithelisation by the main surgeon and a plastic surgeon or a staff nurse. Results: Of the 295 patients whose scalps were used as donor site, 274 were followed from 6 months to 10 years after the procedure (median 18.2 months). Twenty-one patients were lost to follow-up in the first 6 months. No hypertrophic scarring or keloids on the donor site was observed. Five patients (1.82%) presented with folliculitis and two of them were evaluated with small areas of alopecia (0.7%), treated with resection of these areas and primary suture. The average time of epithelisation of the donor site was 7 days. Conclusion: The harvest of thinner split graft from the scalp is a safe procedure. (C) 2009 Elsevier Ltd and ISBI. All rights reserved.

Mucoepidermoid Carcinoma of the Lung Arising at the Primary Site of A Bronchogenic Cyst: Clinical, Cytogenetic, and Molecular Findings

Primary lung tumors are rare in children, and mucoepidermoid carcinoma (MEC) represents less than 10% of them. Additionally, MEC arising from bronchogenic cysts (BC) is particularly unusual. We describe the clinical and genetic findings on a MEC occurring within a previous location of a BC in an adolescent. This particular association has not been previously reported. The lesion revealed normal karyotype without the typical t(11;19)(q21;p13) translocation. Cyclin D1 overexpression (165-fold increase) was demonstrated by real-time PCR although FISH assessment showed normal hybridization at 11q13. Information on these unusual clinical presentations may present relevant insight on tumorigenesis of infrequent pediatric pulmonary tumors. Pediatr Blood Cancer 2011;56:311-313. (C) 2010 Wiley-Liss, Inc.