971 resultados para Salivary Alpha-Amylase


Relevância:

80.00% 80.00%

Publicador:

Resumo:

During bean seed storage, yield can be lost due to infestations of Acanthoscelides obtectus Say, the bean weevil. The use of resistant varieties has shown promising results in fighting these insects, reducing infestation levels and eliminating chemical residues from the beans. The expression of resistance to A. obtectus in bean varieties is frequently attributed to the presence of phytohemagglutinins, protease inhibitors and alpha-amylase, and especially to variants of the protein arcelin, which reduce the larval viability of these insects. To evaluate the effect of bean seed storage time on the resistance expression of bean varieties to A. obtectus, tests with seeds of three ages (freshly-harvested, 4-month-old, and 8-month-old) were conducted in the laboratory, using four commercial varieties: Carioca Pitoco, Ipa 6, Porrillo 70, Onix; four improved varieties containing arcelin protein: Are. 1, Arc.2, Arc. 3, Arc.4; and three wild varieties also containing arcelin protein: Arc. IS, Arc.3S, and Arc. 5S. The Arc.5S, Arc. IS, and Arc.2 varieties expressed high antibiosis levels against the weevil; Arc. I and Arc3S expressed the same mechanism, but at lower levels. The occurrence of oviposition non-preference was also observed in Arc.5S and Arc. IS. The Arc.3 and Arc. 4 varieties expressed low feeding non-preference levels against A. obtectus. The expression of resistance in arcelin-bearing, wild or improved varieties was affected during the storage of seeds, and was high under some parameters but low in others. The results showed that addition of chemical resistance factors such as protein arcelin via genetic breeding may be beneficial in improving the performance of bean crops.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

O uso de reguladores de crescimento na fase de germinação melhora o desempenho das plântulas, acelerando a velocidade de emergência e realçando o potencial das sementes de várias espécies, mesmo sob condições adversas. Este trabalho teve como objetivo avaliar a influência do ácido giberélico na atividade amilolítica e no vigor de sementes armazenadas de milho super doce. O experimento foi conduzido nos Laboratórios de Análise de Sementes do Departamento de Produção Vegetal/FCA e no Laboratório de Bioquímica de Plantas do Departamento de Química e Bioquímica/IB da Universidade Estadual Paulista (UNESP/Botucatu), entre os meses de julho e setembro de 2001, onde foram feitas as avaliações da qualidade fisiológica, através dos testes de germinação, vigor e bioquímicos. Sementes de milho super doce da cultivar DO-04, foram acondicionadas em sacos de papel e armazenadas por oito meses em câmara seca (40% UR). Após este período, foram colocadas para germinar em rolos de papel toalha, embebidos com GA3 nas concentrações zero; 50; 100; 150 e 200mg.L-1. Foram avaliadas a germinação, vigor e atividade amilolítica das sementes. As sementes submetidas à pré-embebição em solução de 50mg.L-1 de ácido giberélico, apresentaram maior germinação e vigor, menor teor de proteínas totais e maior atividade amilolítica.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The Brazilian caatinga is characterized by low annual rainfall and arid soils. Several cactaceae, either native or adapted species, grow in this semi-arid region, including the prickly pear (Opuntia fícus indica) and facheiro ((Philosocereus pachycladus Ritter) which produce underexploited edible fruits. In addition to these species, the algaroba is a leguminous with little studied technological applications and bioactive potential so far. Therefore, this research aims to investigate the physicochemical, bioactive and functional attributes of the prickly pear and facheiro fruit pulps and the algaroba flour. Specifically, this study approaches the physicochemical characterization, total phenolic compounds (TPC) and the betalain identification and quantification by HPLC-DAD-ESI-MS. It is also investigated the DPPH antioxidant capacity and the antienzymatic activities against alpha-amylase and alphaglucosidase of water and ethanolic extracts of these food material. In order to address their potential to be used as food ingredients, juice blends prepared with mixtures of cajá and prickly pear, biofilms with facheiro and cereal bars with algaroba flour were elaborated and analyzed. The prickly pear fruits presented low acidity and high sugar content when compared to facheiro. The Philosocereus pachycladus Ritter fruits had higher protein and ash content, but the algaroba flour was the species with higher protein and sugar content among all. The algaroba flour also presented outstanding food fiber content, which reveals its potentiality to be used as a natural intestinal regulator. The TPC of water and ethanol extracts ranged from 3.87 to 16.21 mg GAE/100g for algaroba flour, 79.24 to 110.20 GAE/ 100g for prickly pear and 412.23 to 539.14 mg GAE/100g for facheiro. The 70% (w/v) ethanol extract reached the highest DPPH antioxidant activity, which was linearly correlated to its high TPC content. In regard to the enzymatic inhibitory activities, the best performance was observed for the prickly pear extracts which presented a moderate inhibition for both investigated enzymes, but interestingly, no alpha-glucosidase inhibition was observed for facheiro extracts. This work shows, for the first time in the literature, the functional attributes of facheiro fruits, as well as the presence of betacianins and isobetanin in the pulp of this exotic fruit. When it comes to the food products developed here, the sensory attributes that better described the juice blend cajá-prickly pear were sweetness, acidity, color yellow-orange, body, turbidity and cajá flavor. The discriminative test applied for cereal bars produced with and without algaroba revealed that the texture was the only sensory attribute that differed (p<0.05) between these two samples. It was also observed that the addition of facheiro extracts did not influence the visual characteristics of the biofilms. Overall, this work unveils the physicochemical and bioactive attributes of these commercial and technologically underexploited species widely found in the Brazilian caatinga and presents alternatives for their rational use

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Extracts and decoctions of Eugenia jambolana Lam., Eugenia uniflora L., and Eugenia punicifolia (Humb., Bonpl. & Kunt) DC. are used in traditional medicine to treat diabetes mellitus. Although there have been reports that Eugenia jambolana and Eugenia uniflora have antidiabetic effects, no study has yet been made on Eugenia punicifolia . We investigated the effects of aqueous, butanol, and methanol extracts of Eugenia punicifolia leaves administered by gavage to streptozotocin-diabetic rats for 26 to 29 days. Body weight, food and fluid intake, urine volume, and urinary glucose and urea were evaluated every 7 days. At the end of the experiment, we measured serum cholesterol, high-density lipoprotein (HDL)-cholesterol, triglycerides and bilirubin, hepatic glycogen and serum marker-enzymes (alanine and aspartate aminotransferases, alkaline phosphatase, gamma-glutamyltransferase, L-lactate dehydrogenase, creatine kinase, alpha-amylase, and angiotensin I converting enzyme). We found that in rats treated with the aqueous extracts, food and liquid intake, urinary volume, and body weight were all reduced, while for rats treated with the methanol extract, not only were liquid intake, urinary volume and body weight reduced, but urinary glucose and urea also decreased. Rats treated with the butanol extract showed no significant alterations in any of the parameters measured. Chronic treatment with extracts had no effect on the marker enzymes nor on serum bilirubin levels. The results indicate that aqueous extracts of Eugenia punicifolia leaves produced an anorexic effect and that methanol extracts had a beneficial effect on the diabetic state by improving carbohydrate and protein metabolism without provoking hepatobiliary, microvascular, muscular, or pancreatic toxic effects.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The protein complement of the secretion from hypopharyngeal gland of nurse-bees (Apis mellifera L.) was partially identified by using a combination of 2D-PAGE, peptide sequencing by MALDI-PSD/MS and a protein engine identification tool applied to the honeybee genome. The proteins identified were compared to those proteins already identified in the proteome complement of the royal jelly of the honey bees. The 2D gel electrophoresis demonstrated this protein complement is constituted of 61 different polypepides, from which 34 were identified as follows: 27 proteins belonged to MRJPs family, 5 proteins were related to the metabolism of carbohydrates and to the oxido-reduction metabolism of energetic Substrates, I protein was related to the accumulation of iron in honeybee bodies and I protein may be a regulator of MRJP-1 oligomerization. The proteins directly involved with the carbohydrates and energetic metabolisms were: alpha glucosidase, glucose oxidase and alpha amylase, whose are members of the same family of enzymes, catalyzing the hydrolysis of the glucosidic linkages of starch; alcohol dehydrogenase and aldehyde dehydrogenase, whose are constituents of the energetic metabolism. The results of the present manuscript support the hypothesis that the most of these proteins are produced in the hypoharyngeal gland of nurse-bees and secreted into the RJ. (C) 2004 Elsevier Ltd. All rights reserved.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Branching enzyme catalyzes the formation of alpha-1,6 branch points in either glycogen or starch. We report the 2.3-Angstrom crystal structure of glycogen branching enzyme from Escherichia coli. The enzyme consists of three major domains, an NH2-terminal seven-stranded beta-sandwich domain, a COOH-terminal domain, and a central alpha/beta-barrel domain containing the enzyme active site. While the central domain is similar to that of all the other amylase family enzymes, branching enzyme shares the structure of all three domains only with isoamylase. Oligosaccharide binding was modeled or branching enzyme using the enzyme-oligosaccharide complex structures of various alpha-amylases and cyclodextrin glucanotransferase and residues were implicated in oligosaccharide binding. While most of the oligosaccharides modeled well in the branching enzyme structure, an approximate 50degrees rotation between two of the glucose units was required to avoid steric clashes with Trp(298) of branching enzyme. A similar rotation was observed in the mammalian alpha-amylase structure caused by an equivalent tryptophan residue in this structure. It appears that there are two binding modes for oligosaccharides in these structures depending on the identity and location of this aromatic residue.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

In this study the relationship between the enzymatic susceptibility and the size of the com and cassava starch granules was studied. The starch granules were separated by size and classified according to their average diameter in: a) larger than 16 mum; b) between 15 and 10 mum and c) smaller than 10 mum. The starch granules of various sizes were hydrolyzed by bacterial alpha-amylase and fungal amyloglucosidase. The results showed a relationship between the enzymatic susceptibility and the size of the starch granules; smaller size of the starch granules resulted in a higher percentage of hydrolysis. A basic difference in the mode of action of enzymes on small and large granules was observed. Enzymatic attack on the large granules was characterized by considerable surface corrosion, mainly at the radial axis. For small granules, the enzymatic action occurred on the surface of the granules and was characterized by an erosion with solubilization of the granules. Chemical and physical analysis of the starches suggested that hydrolysis should occur mainly at the amorphous areas of the granules.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Rhizopus microsporus var. rhizopodiformis produced high levels of alpha-amylase and glucoamylase under solid state fermentation, with several agricultural residues, such as wheat bran, cassava flour, sugar cane bagasse, rice straw, corncob and crushed corncob as carbon sources. These materials were humidified with distilled water, tap water, or saline solutions-Segato Rizzatti (SR), Khanna or Vogel. The best substrate for amylase production was wheat bran with SR saline solution (1:2 v/v). Amylolytic activity was still improved (14.3%) with a mixture of wheat bran, corncob, starch and SR saline solution (1:1:0.3:4.6 w/w/w/v). The optimized culture conditions were initial pH 5, at 45 degrees C during 6 days and relative humidity around 76%. The crude extract exhibited temperature and pH optima around 65 degrees C and 4-5, respectively. Amylase activity was fully stable for 1 h at temperatures up to 75 degrees C, and at pH values between 2.5 and 7.5.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)