875 resultados para Reserve carbohydrates and tillering
Resumo:
Obesity is sweeping the westernized world at a rate which far outstrips human genomic evolution, highlighting the importance of the obesogenic environment. Diet is an important component of this obesogenic environment, with certain diets (high fat, high refined carbohydrates and sugar) predisposing to overweight. On the other hand, there are also foods shown to protect against obesity and the diseases of obesity, including whole plant foods, dairy products, dietary fibre and functional foods like probiotics, prebiotics and phytochemicals. Interestingly, many of these foods mediate their health-promoting activities through the gut microbiota. The human gut microbiota itself has recently been identified as a contributory factor in this obesogenic environment, with differences observed between lean and obese. Evidence from human studies indicates that important groups of fermentative bacteria differ in abundance between lean and obese. Recently it has been suggested that anomalous microbiota composition in infancy can predispose to overweight in later life, highlighting the important role of optimal microbiota successional development, and that – as observed in laboratory animals – the gut microbiota may contribute to the aetiology of obesity. In this review we will introduce the gut microbiota, describe its interactions with major dietary components and the host, and then go on to discuss evidence indicating that the gut microbiota may contribute to the obesogenic environment. Finally, we will explore possible strategies for modulating the composition and activity of the human gut microbiota which may impact on obesity or the metabolic diseases associated with obesity. (Nutritional Therapy & Metabolism 2009; 27: 113-33)
Resumo:
This study was aimed at determining whether an increase of 5 portions of fruits and vegetables in the form of soups and beverages has a beneficial effect on markers of oxidative stress and cardiovascular disease risk factors. The study was a single blind, randomized, controlled, crossover dietary intervention study. After a 2-wk run-in period with fish oil supplementation, which continued throughout the dietary intervention to increase oxidative stress, the volunteers consumed carotenoid-rich or control vegetable soups and beverages for 4 wk. After a 10-wk wash-out period, the volunteers repeated the above protocol, consuming the other intervention foods. Both test and control interventions significantly increased the % energy from carbohydrates and decreased dietary protein and vitamin B-12 intakes. Compared with the control treatment, consumption of the carotenoid-rich soups and beverages increased dietary carotenoids, vitamin C, alpha-tocopherol, potassium, and folate, and the plasma concentrations of alpha-carotene (362%), beta-carotene (250%) and lycopene (31%) (P < 0.01) and decreased the plasma homocysteine concentration by 8.8% (P < 0.01). The reduction in plasma homocysteine correlated weakly with the increase in dietary folate during the test intervention (r = -0.35, P = 0.04). The plasma antioxidant status and markers of oxidative stress were not affected by treatment. Consumption of fruit and vegetable soups and beverages makes a useful contribution to meeting dietary recommendations for fruit and vegetable consumption.
Resumo:
In this work libraries of morpholines and oxazepanes have been prepared via the reductive amination reaction between dialdehydes, derived from carbohydrates, and a range of amines. In this way, functionalised morpholines and oxazepanes have been prepared that include N-alkylated derivatives, disaccharide analogues, and ester containing derivatives. The abilities of these functionalised morpholines and oxazepanes to inhibit a broad panel of glycosidase enzymes, that are associated with a range of diseases, have been probed and in this way new inhibitors of a range of glycosidases, but particularly β-d-galactosidase derived from Bovine kidney, have been discovered. N-Alkyl morpholines demonstrated the best inhibition profiles for this enzyme and derivatives (15a)–(15d) acted as non-competitive inhibitors with IC50 values of 55.1–88.6 μM. Within this study, some preliminary structure–activity relationships are proposed, and it is demonstrated that N-substituted morpholines display better inhibitory profiles for the enzymes analysed than any of the N-substituted oxazepanes.
Resumo:
The first application of high field NMR spectroscopy (800 MHz for 1H observation) to human hepatic bile (as opposed to gall bladder bile) is reported. The bile sample used for detailed investigation was from a donor liver with mild fat infiltration, collected during organ retrieval prior to transplantation. In addition, to focus on the detection of bile acids in particular, a bile extract was analysed by 800 MHz 1H NMR spectroscopy, HPLC-NMR/MS and UPLC-MS. In the whole bile sample, 40 compounds have been assigned with the aid of two-dimensional 1H–1H TOCSY and 1H–13C HSQC spectra. These include phosphatidylcholine, 14 amino acids, 10 organic acids, 4 carbohydrates and polyols (glucose, glucuronate, glycerol and myo-inositol), choline, phosphocholine, betaine, trimethylamine-N-oxide and other small molecules. An initial NMR-based assessment of the concentration range of some key metabolites has been made. Some observed chemical shifts differ from expected database values, probably due to a difference in bulk diamagnetic susceptibility. The NMR spectra of the whole extract gave identification of the major bile acids (cholic, deoxycholic and chenodeoxycholic), but the glycine and taurine conjugates of a given bile acid could not be distinguished. However, this was achieved by HPLC-NMR/MS, which enabled the separation and identification of ten conjugated bile acids with relative abundances varying from approximately 0.1% (taurolithocholic acid) to 34.0% (glycocholic acid), of which, only the five most abundant acids could be detected by NMR, including the isomers glycodeoxycholic acid and glycochenodeoxycholic acid, which are difficult to distinguish by conventional LC-MS analysis. In a separate experiment, the use of UPLC-MS allowed the detection and identification of 13 bile acids. This work has shown the complementary potential of NMR spectroscopy, MS and hyphenated NMR/MS for elucidating the complex metabolic profile of human hepatic bile. This will be useful baseline information in ongoing studies of liver excretory function and organ transplantation.
Resumo:
Traditionally, siting and sizing decisions for parks and reserves reflected ecological characteristics but typically failed to consider ecological costs created from displaced resource collection, welfare costs on nearby rural people, and enforcement costs. Using a spatial game-theoretic model that incorporates the interaction of socioeconomic and ecological settings, we show how incorporating more recent mandates that include rural welfare and surrounding landscapes can result in very different optimal sizing decisions. The model informs our discussion of recent forest management in Tanzania, reserve sizing and siting decisions, estimating reserve effectiveness, and determining patterns of avoided forest degradation in Reduced Emissions from Deforestation and Forest Degradation programs.
Resumo:
Seeds sprouts have been used as a good source of basic nutrients and nutraceutical compounds. The high nutritional value of seeds derives from the deposition of compounds during development. However some of these molecules are used in metabolic processes like germination, which leads to a considerable variation in their concentrations once these events are completed. In this work, we investigate the levels of inositols (myo-inositol, D-pinitol and ononitol), soluble carbohydrates and proteins in cotyledons of Phaseolus vulgaris and Vigna unguiculata sprouts. Sprouting increased myo-inositol and glucose content and reduction of raffinose and ononitol was observed. The protein levels increased in P. vulgaris and decreased in V. unguiculata sprouting. The level of sucrose was maintained in both sprouts. D-Pinitol was detected only in quiescent seeds. Our results suggested that bean sprout is an important source of proteins, sucrose, glucose and myo-inositol. Additionally, bean sprouts have low levels of raffinose, an antinutritional compound.
Resumo:
Lectins have been classified into a structurally diverse group of proteins that bind carbohydrates and glycoconjugates with high specificity. They are extremely useful molecules in the characterization of saccharides, as drug delivery mediators, and even as cellular surface makers. In this study, we present camptosemin, a new lectin from Camptosema ellipticum. It was characterized as an N-acetyl-d-galactosamine-binding homo-tetrameric lectin, with a molecular weight around 26 kDa/monomers. The monomers were stable over a wide range of pH values and exhibited pH-dependent oligomerization. Camptosemin promoted adhesion of breast cancer cells and hemagglutination, and both activities were inhibited by its binding of sugar. The stability and unfolding/folding behavior of this lectin was characterized using fluorescence and far-UV circular dichroism spectroscopies. The results indicate that chemical unfolding of camptosemin proceeds as a two-state monomer-tetramer process. In addition, small-angle X-ray scattering shows that camptosemin behaves as a soluble and stable homo-tetramer molecule in solution.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
O presente estudo teve como objetivo avaliar a composição nutricional dos cogumelos produzidos em substratos alternativos à base de resíduos agrícolas e agroindustriais da Amazônia. Determinou-se C, N, pH, umidade, sólidos solúveis, proteína, lipídios, fibra total, cinzas, carboidratos e energia. Os substratos foram formulados a partir de serragem de Simarouba amara Aubl. (marupá), Ochroma piramidale Cav. ex. Lam. (pau de balsa) e do estipe de Bactris gasipaes Kunth (pupunheira) e de Saccharum officinarum (cana-de-açúcar). Os resultados demonstraram que: a composição nutricional do P. ostreatus variou com o substrato de cultivo e; O P. ostreatus pode ser considerado um importante alimento devido suas características nutricionais: altos teores de proteínas, carboidratos metabolizáveis e fibras; baixos teores de lipídios e de calorias.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)