Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Ectopic expression of prion protein (PrP) in T lymphocytes or hepatocytes of PrP knockout mice is insufficient to sustain prion replication

The cellular form of the Prion protein (PrPC) is necessary for prion replication in mice. To determine whether it is also sufficient, we expressed PrP under the control of various cell- or tissue-specific regulatory elements in PrP knockout mice. The interferon regulatory factor-1 promoter/E�� enhancer led to high PrP levels in the spleen and low PrP levels in the brain. Following i.p. scrapie inoculation, high prion titers were found in the spleen but not in the brain at 2 weeks and 6 months, showing that the lymphoreticular system by itself is competent to replicate prions. PrP expression directed by the Lck promoter resulted in high PrP levels on T lymphocytes only but, surprisingly, did not allow prion replication in the thymus, spleen, or brain following i.p. inoculation. A third transgenic line, which expressed PrP in the liver under the control of the albumin promoter/enhancer���albeit at low levels���also failed to replicate prions. These results show that expression of PrP alone is not sufficient to sustain prion replication and suggest that additional components are needed.

Two sterol regulatory element-like sequences mediate up-regulation of caveolin gene transcription in response to low density lipoprotein free���cholesterol

Caveolae form the terminus for a major pathway of intracellular free cholesterol (FC) transport. Caveolin mRNA levels in confluent human skin fibroblasts were up-regulated following increased uptake of low density lipoprotein (LDL) FC. The increase induced by FC was not associated with detectable change in mRNA stability, indicating that caveolin mRNA levels were mediated at the level of gene transcription. A total of 924 bp of 5��� flanking region of the caveolin gene were cloned and sequenced. The promoter sequence included three G+C-rich potential sterol regulatory elements (SREs), a CAAT sequence and a Sp1 consensus sequence. Deletional mutagenesis of individual SRE-like sequences indicated that of these two (at ���646 and ���395 bp) were essential for the increased transcription rates mediated by LDL-FC, whereas the third was inconsequential. Gel shift analysis of protein binding from nuclear extracts to these caveolin promoter DNA sequences, together with DNase I footprinting, confirmed nucleoprotein binding to the SRE-like elements as part of the transcriptional response to LDL-FC. A supershift obtained with antibody to SRE-binding protein 1 (SPEBP-1) indicated that this protein binds at ���395 bp. There was no reaction at ���395 bp with anti-Sp1 antibody nor with either antibody at ���646 bp. The cysteine protease inhibitor N-acetyl-leu-leu-norleucinal (ALLN), which inhibits SREBP catabolism, superinhibited caveolin mRNA levels regardless of LDL-FC. This finding suggests that SREBP inhibits caveolin gene transcription in contrast to its stimulating effect on other promoters. The findings of this study are consistent with the postulated role for caveolin as a regulator of cellular FC homeostasis in quiescent peripheral cells, and the coordinate regulation by SREBP of FC influx and efflux.

Precisely full length, circularizable, complementary RNA: An infectious form of potato spindle tuber viroid

The replication of many viral and subviral pathogens as well as the amplification of certain cellular genes proceeds via a rolling circle mechanism. For potato spindle tuber (PSTVd) and related viroids, the possible role of a circular (���)strand RNA as a template for synthesis of (+)strand progeny is unclear. Infected plants appear to contain only multimeric linear (���)strand RNAs, and attempts to initiate infection with multimeric (���)PSTVd RNAs generally have failed. To examine critically the infectivity of monomeric (���)strand viroid RNAs, we have developed a ribozyme-based expression system for the production of precisely full length (���)strand RNAs whose termini are capable of undergoing facile circularization in vitro. Mechanical inoculation of tomato seedlings with electrophoretically purified (���)PSTVd RNA led to a small fraction of plants becoming infected whereas parallel assays with an analogous tomato planta macho viroid (���)RNA resulted in a much larger fraction of infected plants. Ribozyme-mediated production of (���)PSTVd RNA in transgenic plants led to the appearance of monomeric circular (���)PSTVd RNA and large amounts of (+)PSTVd progeny. No monomeric circular (���)PSTVd RNA could be detected in naturally infected plants by using either ribonuclease protection or electrophoresis under partially denaturing conditions. Although not a component of the normal replicative pathway, precisely full length (���)PSTVd RNA appears to contain all of the structural and regulatory elements necessary for initiation of viroid replication.

Repression of transcription mediated by dual elements in the CCAAT/enhancer binding protein �����gene

During adipocyte differentiation, the expression of C/EBP�� is activated, which in turn serves to transcriptionally activate numerous adipocyte genes. A previous search for cis elements that regulate transcription of the C/EBP�� gene led to the identification of a potential repressive element within the proximal 5��� flanking region of the gene. Nuclear extracts from 3T3-L1 preadipocytes, but not adipocytes, were found to contain a factor, CUP (C/EBP�� undifferentiated protein), that binds to this site (the CUP-1 site). In the present investigation, we show that C/EBP�� promoter-luciferase constructs containing both the proximal 5��� flanking and the entire 5��� untranslated regions of the gene exhibit an expression pattern during adipocyte differentiation comparable to that of the endogenous C/EBP�� gene. Mutation of the CUP-1 site in these constructs had little effect on reporter gene expression; however, when this mutation was combined with deletion of the 5��� untranslated region, reporter gene expression by preadipocytes was dramatically up-regulated. Consistent with this finding, a second CUP binding site (the CUP-2 site) was identified in the 5��� untranslated region. Although mutation of either CUP element in constructs containing both the 5��� flanking and 5��� untranslated region had little effect on reporter gene transcription, mutation of both CUP elements markedly activated transcription. Thus, it appears that dual CUP regulatory elements repress transcription of the C/EBP�� gene prior to induction of the adipocyte differentiation program.

NADH-Glutamate Synthase in Alfalfa Root Nodules. Genetic Regulation and Cellular Expression1

NADH-dependent glutamate synthase (NADH-GOGAT; EC 1.4.1.14) is a key enzyme in primary nitrogen assimilation in alfalfa (Medicago sativa L.) root nodules. Here we report that in alfalfa, a single gene, probably with multiple alleles, encodes for NADH-GOGAT. In situ hybridizations were performed to assess the location of NADH-GOGAT transcript in alfalfa root nodules. In wild-type cv Saranac nodules the NADH-GOGAT gene is predominantly expressed in infected cells. Nodules devoid of bacteroids (empty) induced by Sinorhizobium meliloti 7154 had no NADH-GOGAT transcript detectable by in situ hybridization, suggesting that the presence of the bacteroid may be important for NADH-GOGAT expression. The pattern of expression of NADH-GOGAT shifted during root nodule development. Until d 9 after planting, all infected cells appeared to express NADH-GOGAT. By d 19, a gradient of expression from high in the early symbiotic zone to low in the late symbiotic zone was observed. In 33-d-old nodules expression was seen in only a few cell layers in the early symbiotic zone. This pattern of expression was also observed for the nifH transcript but not for leghemoglobin. The promoter of NADH-GOGAT was evaluated in transgenic alfalfa plants carrying chimeric ��-glucuronidase promoter fusions. The results suggest that there are at least four regulatory elements. The region responsible for expression in the infected cell zone contains an 88-bp direct repeat.

Grass genomes

For the most part, studies of grass genome structure have been limited to the generation of whole-genome genetic maps or the fine structure and sequence analysis of single genes or gene clusters. We have investigated large contiguous segments of the genomes of maize, sorghum, and rice, primarily focusing on intergenic spaces. Our data indicate that much (>50%) of the maize genome is composed of interspersed repetitive DNAs, primarily nested retrotransposons that insert between genes. These retroelements are less abundant in smaller genome plants, including rice and sorghum. Although 5- to 200-kb blocks of methylated, presumably heterochromatic, retrotransposons flank most maize genes, rice and sorghum genes are often adjacent. Similar genes are commonly found in the same relative chromosomal locations and orientations in each of these three species, although there are numerous exceptions to this collinearity (i.e., rearrangements) that can be detected at the levels of both the recombinational map and cloned DNA. Evolutionarily conserved sequences are largely confined to genes and their regulatory elements. Our results indicate that a knowledge of grass genome structure will be a useful tool for gene discovery and isolation, but the general rules and biological significance of grass genome organization remain to be determined. Moreover, the nature and frequency of exceptions to the general patterns of grass genome structure and collinearity are still largely unknown and will require extensive further investigation.

Regulation of the stem cell leukemia (SCL) gene: A tale of two fishes

The stem cell leukemia (SCL) gene encodes a tissue-specific basic helix���loop���helix (bHLH) protein with a pivotal role in hemopoiesis and vasculogenesis. Several enhancers have been identified within the murine SCL locus that direct reporter gene expression to subdomains of the normal SCL expression pattern, and long-range sequence comparisons of the human and murine SCL loci have identified additional candidate enhancers. To facilitate the characterization of regulatory elements, we have sequenced and analyzed 33 kb of the SCL genomic locus from the pufferfish Fugu rubripes, a species with a highly compact genome. Although the pattern of SCL expression is highly conserved from mammals to teleost fish, the genes flanking pufferfish SCL were unrelated to those known to flank both avian and mammalian SCL genes. These data suggest that SCL regulatory elements are confined to the region between the upstream and downstream flanking genes, a region of 65 kb in human and 8.5 kb in pufferfish. Consistent with this hypothesis, the entire 33-kb pufferfish SCL locus directed appropriate expression to hemopoietic and neural tissue in transgenic zebrafish embryos, as did a 10.4-kb fragment containing the SCL gene and extending to the 5��� and 3��� flanking genes. These results demonstrate the power of combining the compact genome of the pufferfish with the advantages that zebrafish provide for studies of gene regulation during development. Furthermore, the pufferfish SCL locus provides a powerful tool for the manipulation of hemopoiesis and vasculogenesis in vivo.

Light regulation of type IV pilus-dependent motility by chemosensor-like elements in Synechocystis PCC6803

To optimize photosynthesis, cyanobacteria move toward or away from a light source by a process known as phototaxis. Phototactic movement of the cyanobacterium Synechocystis PCC6803 is a surface-dependent phenomenon that requires type IV pili, cellular appendages implicated in twitching and social motility in a range of bacteria. To elucidate regulation of cyanobacterial motility, we generated transposon-tagged mutants with aberrant phototaxis; mutants were either nonmotile or exhibited an ���inverted motility response��� (negative phototaxis) relative to wild-type cells. Several mutants contained transposons in genes similar to those involved in bacterial chemotaxis. Synechocystis PCC6803 has three loci with chemotaxis-like genes, of which two, Tax1 and Tax3, are involved in phototaxis. Transposons interrupting the Tax1 locus yielded mutants that exhibited an inverted motility response, suggesting that this locus is involved in controlling positive phototaxis. However, a strain null for taxAY1 was nonmotile and hyperpiliated. Interestingly, whereas the C-terminal region of the TaxD1 polypeptide is similar to the signaling domain of enteric methyl-accepting chemoreceptor proteins, the N terminus has two domains resembling chromophore-binding domains of phytochrome, a photoreceptor in plants. Hence, TaxD1 may play a role in perceiving the light stimulus. Mutants in the Tax3 locus are nonmotile and do not make type IV pili. These findings establish links between chemotaxis-like regulatory elements and type IV pilus-mediated phototaxis.

Dehydration-Stress-Regulated Transgene Expression in Stably Transformed Rice Plants1

To confer abscisic acid (ABA) and/or stress-inducible gene expression, an ABA-response complex (ABRC1) from the barley (Hordeum vulgare L.) HVA22 gene was fused to four different lengths of the 5��� region from the rice (Oryza sativa L.) Act1 gene. Transient assay of ��-glucuronidase (GUS) activity in barley aleurone cells shows that, coupled with ABRC1, the shortest minimal promoter (Act1���100P) gives both the greatest induction and the highest level of absolute activity following ABA treatment. Two plasmids with one or four copies of ABRC1 combined with the same Act1���100P and HVA22(I) of barley HVA22 were constructed and used for stable expression of uidA in transgenic rice plants. Three Southern blot-positive lines with the correct hybridization pattern for each construct were obtained. Northern analysis indicated that uidA expression is induced by ABA, water-deficit, and NaCl treatments. GUS activity assays in the transgenic plants confirmed that the induction of GUS activity varies from 3- to 8-fold with different treatments or in different rice tissues, and that transgenic rice plants harboring four copies of ABRC1 show 50% to 200% higher absolute GUS activity both before and after treatments than those with one copy of ABRC1.

Molecular heterogeneity of progenitors and radial migration in the developing cerebral cortex revealed by transgene expression.

We have analyzed the developmental pattern of beta-galactosidase (beta-gal) expression in the cerebral cortex of the beta 2nZ3'1 transgenic mouse line, which was generated using regulatory elements of the beta 2-microglobulin gene and shows ectopic expression in nervous tissue. From embryonic day 10 onward, beta-gal was expressed in the medial and dorsal cortices, including the hippocampal region, whereas lateral cortical areas were devoid of labeling. During the period of cortical neurogenesis (embryonic days 11-17), beta-gal was expressed by selective precursors in the proliferative ventricular zone of the neocortex and hippocampus, as well as by a number of migrating and postmigratory neurons arranged into narrow radial stripes above the labeled progenitors. Thus, the transgene labels a subset of cortical progenitors and their progeny. Postnatally, radial clusters of beta-gal-positive neurons were discernible until postpartum day 10. At this age, the clusters were 250 to 500 microns wide, composed of neurons spanning all the cortical layers and exhibiting several neuronal phenotypes. These data suggest molecular heterogeneity of cortical progenitors and of the cohorts of postmitotic neurons originating from them, which implies intrinsic molecular mosaicism in both cortical progenitors and developing neurons. Furthermore, the data show that neurons committed to the expression of the transgene migrate along very narrow, radial stripes.

Mouse model of human beta zero thalassemia: targeted deletion of the mouse beta maj- and beta min-globin genes in embryonic stem cells.

beta zero-Thalassemia is an inherited disorder characterized by the absence of beta-globin polypeptides derived from the affected allele. The molecular basis for this deficiency is a mutation of the adult beta-globin structural gene or cis regulatory elements that control beta-globin gene expression. A mouse model of this disease would enable the testing of therapeutic regimens designed to correct the defect. Here we report a 16-kb deletion that includes both adult beta-like globin genes, beta maj and beta min, in mouse embryonic stem cells. Heterozygous animals derived from the targeted cells are severely anemic with dramatically reduced hemoglobin levels, abnormal red cell morphology, splenomegaly, and markedly increased reticulocyte counts. Homozygous animals die in utero; however, heterozygous mice are fertile and transmit the deleted allele to progeny. The anemic phenotype is completely rescued in progeny derived from mating beta zero-thalassemic animals with transgenic mice expressing high levels of human hemoglobin A. The beta zero-thalassemic mice can be used to test genetic therapies for beta zero-thalassemia and can be bred with transgenic mice expressing high levels of human hemoglobin HbS to produce an improved mouse model of sickle cell disease.

Elucidating the cis-regulatory landscape of retinal development and regeneration

Thesis (Ph.D.)--University of Washington, 2016-04

Ultraconserved elements in the human genome

There are 481 segments longer than 200 base pairs (bp) that are absolutely conserved (100% identity with no insertions or deletions) between orthologous regions of the human, rat, and mouse genomes. Nearly all of these segments are also conserved in the chicken and dog genomes, with an average of 95 and 99% identity, respectively. Many are also significantly conserved in fish. These ultraconserved elements of the human genome are most often located either overlapping exons in genes involved in RNA processing or in introns or nearby genes involved in the regulation of transcription and development. Along with more than 5000 sequences of over 100 bp that are absolutely conserved among the three sequenced mammals, these represent a class of genetic elements whose functions and evolutionary origins are yet to be determined, but which are more highly conserved between these species than are proteins and appear to be essential for the ontogeny of mammals and other vertebrates.

Endothelin receptor B and neural crest derived melanocyte development

Neural Crest cells (NCC) constitute a unique embryonic cell population that arises between the prospective epidermis and the dorsal aspect of the neural tube of vertebrates. NCC migrate ventromedially and dorsolaterally throughout the developing embryo giving rise to the peripheral nervous system constituents and melanocytes that ultimately reside in the skin and hair follicles respectively. Mice and humans with mutations in the Endothelin receptor b (Ednrb) gene manifest strikingly similar phenotypes characterized by hypopigmentation, hearing loss and megacolon these are due to absence of melanocytes in the skin and inner ear and lack of enteric ganglia in the distal part of the gut, respectively. Piebald lethal mice and humans with Hirschsprung's disease or Waardenburg syndrome carry different mutations in the Ednrb gene. The major goals of this project were to determine whether the action of Ednrb in NCC is required prior to commitment of these cells to the melanocytic lineage and to investigate its potential participation in the actual process of commitment. In order to achieve these goals transgenic mice that express Ednrb under two different regulatory elements were created. The first, Dct-Ednrb, expresses Ednrb under the control of the DOPAchrome tautomerase (Dct) promoter to direct expression to already committed melanocyte precursors. The second, Nes-Ednrb, expresses Ednrb under the regulation of the human nestin gene second enhancer to direct expression to pre-migratory NCC. Crosses of the Dct-Ednrb mouse with piebald lethal showed that the transgene was capable of rescuing the hypopigmentation phenotype of the later. This result indicates that the action of Ednrb after NCC commit to the melanocytic lineage is sufficient for normal melanocyte development. The Dct-Ednrb was further crossed with two other hypopigmentation mutants that carry mutations in the transcription factors Sox10 and Pax3. The transgene rescued the phenotype of the Sox10 mutant only. This suggests that Ednrb interacts with Sox10 but not with Pax3 during melanocyte development. The Nes-Ednrb mice developed a hypopigmentation phenotype that was augmented when crossed with piebald lethal or lethal spotting (mutation in Edn3, the ligand for Ednrb) mice but was rescued by over expression of Edn3. These results suggest that alterations in Ednrb expression early in development affect melanocyte development. This study provides novel information necessary to better understand the early embryonic development of NCC, clarifies specific interactions between different melanogenic genes and, could eventually help in the implementation of therapies for human pigmentary genetic disorders. ^