937 resultados para RUTHENIUM(III) COMPLEXES
Resumo:
The efficient synthesis of 5-(5-bromovaleramido)-1,10-phenanthroline, 5-(6-bromohexanamido)-1,10-phenanthroline, and 5-(11-bromoundecanamido)-1,10-phenanthroline are described, which reacted with cis-Ru(bpy)(2)Cl-2. 2H(2)O and sodium hexafluorophosphate to form Ru(bpy)(2)[phen-NHCO(CH2)(n)Br](PF6)(2) (n = 4, 5 or 10; phen = 1,10-phenanthroline). The intricate H-1 NMR spectra at low field of these complexes were completely assigned in virtue of H-1-H-1 COSY technique. Cyclic voltammetry was used to study electrochemical behaviours of these complexes, and their luminescent properties were investigated with fluorescent spectra.
Resumo:
The solution structures of diamagnetic lanthanide (III) complexes of DTPA-BIN (Ln = La, Y, Lu, Sc) have been investigated by H-1 NMR, C-13 NMR and 2D NMR. For each complex, two or more species of asymmetric conformations with little distinction were identified at room temperature. And their solution structures vary with the radius of the central metals. NMR spectra support the hypothesis that Sc3+ with smaller radius formed an eight-coordinated structure with DTPA-BIN, La3+ with larger radius formed nine- or ten-coordinated structures with DTPA-BIN, and Y (DTPA-BIN) and Lu (DTPA-BIN) had nine-coordinated solution structures. The solution structure of Gd (DTPA-BIN) was obtained from the similarity of radius between Gd3+ and Y3+, which is a nine-coordinated structure formed by three nitrogens, three acetate oxygens, two acetyl oxygens, one water molecule and a gadolinium(III) cation.
Resumo:
Four novel polymeric lanthanide(III) complexes of two new double betaine derivatives have been synthesized and structurally determined. In [{La-2(L-1)(2)(H2O)(9)}(n)]Cl-6n. 2nH(2)O (1) and [{Tb(L-1)(H2O)(4)}(n)]Cl-3n. nH(2)O (2) (L-1 =4,4'-trimethylenedipyridinio-N,N'-diacetate), the lanthanide(III) ions form a two-dimensional layer in which each pair of lanthanide(III) ions is bridged by two syn-anti mu-carboxylato-O,O' groups. Adjacent layers are cross-linked through hydrogen bonds among aqua ligands, lattice water molecules and chloride ions, to form a three-dimensional network. Isomorphous [{Ln(L-1)(H2O)(4)}(n)]Cl-3n. 5nH(2)O (Ln=La, 3; Ln=Tb, 4; L-2=1,3 bis(pyridinio-4-carboxylato)-propane) each contain a centrosymmetric paddle-wheel-like dimeric unit in which each pair of adjacent metal atoms is bridged by four syn-syn mu-carboxylato-O,O' groups that are oriented nearly perpendicular to each other about the metal-metal axis. Neighboring dimeric subunits are bridged by a pair of flexible LL ligands into a polymeric chain. Adjacent chains are inter-linked by hydrogen bonds among aqua ligands, lattice water molecules and chloride ions into a three-dimensional network. (C) 1999 Elsevier Science Ltd. All rights reserved.
Resumo:
Stability and luminescence properties of Tb (III) complexes with adrenaline have been studied. The Tb (III) complexes with adrenaline are quite stable. The fluorescence spectra of the Tb (III) complexes with adrenaline show the characteristic fluorescence bands of Tb (III) ions which are attributed to energy transfer from ligands to Tb (III) ions.
Resumo:
Four new polymeric lanthanide(III) complexes of nicotinic acid N-oxide and isonicotinic acid N-oxide have been synthesized and structurally determined. In the isomorphous compounds [(Ln(L-1)(3) (H2O)(2))(n)]. 4nH(2)O(HL1 = nicotinic acid N-oxide; Ln = Eu, 1; Ln = Er, 2) the lanthanide(III) ions form infinite double chains along the b direction through the coordination of bridging carboxylate and N-oxide groups. The chains are cross-linked through hydrogen bonds between aqua ligands and uncoordinated N-oxide groups and between aqua ligands and lattice water molecules, to form a three-dimensional network. [(Eu(L-2)(2)-(H2O)(4))(n)](NO3)(n). nH(2)O (HL2 = isonicotinic acid N-oxide, 3) has a polymeric structure in which the europium (III) ions are connected into infinite chains by pairs of syn-syn carboxylate groups. Adjacent chains are interlinked by hydrogen bonds between aqua ligands and N-oxide groups to form a layer parallel to the (100) plane, and such layers are connected by hydrogen bonds between nitrate anions and aqua ligands, and between oxide groups and lattice water molecules, into a three-dimensional network. In [(Er-2(L-2)(4)(H2O)(10))](NO3)(2). H2O, 4, dinuclear units are inter-linked into a three-dimensional network through hydrogen bonding between aqua ligands and N-oxide groups of both bidentate bridging and unidentate L-2 ligands. Factors affecting the formation of coordination chains and dinuclear units are discussed. Luminescence properties of 1 and 3 have also been studied. (C) 1998 Elsevier Science Ltd. All rights reserved.
Resumo:
[GRAPHICS]
Resumo:
Novel bifunctional ruthenium(n) complexes, [Ru(TAP)2(POQ-Nmet)]2+ and [Ru(BPY)2(POQ-Nmet)]2+(la, 2a), containing a metallic and an organic moiety, have been prepared as photoprobes and photoreagents of DNA(TAP = 1,4,5,8-tetraazaphenanthrene, POQ-Nmet = 5-[6-(7-chloroquinolin-4-yl)-3-thia-6-azaheptanamido]-l,10phenanthroline). The ES mass spectrometry and 'H NMR data in organic solvents indicate that the quinoline moiety exists in both the protonated and non-protonated form. Moreover, the comparison of the NMR data with those of the corresponding monofunctional complexes(without quinoline) evidences that [Ru(TAP).2(POQ-Nmet)]2+ and [Ru(BPY)J(POQ-Nmet)]2+ are unfolded when the quinoline unit is protonated whereas deprotonation permits folding of the molecule. In the folded state the spatial proximity of the electron donor(the organic moiety) and electron acceptor(the metallic moiety) in [Ru(TAP)2(POQ-Nmet)]2+ favours intramolecular photo-induced electron transfer, which has been shown in a previous study to be responsible for the very low luminescence of la in non-protonating solutions. The restoration of the luminescence by protonation of the quinoline moiety as observed previously is in agreement with the unfolding of the molecule demonstrated in this work. The existence of such folding-unfolding processes related to protonation is crucial for studies of la with DNA. © The Royal Society of Chemistry 2000.
Resumo:
A new series of iron(III) complexes [Fe(L(1))(HL(1))], [Fe(L(1)) Cl]; [H2L(1) = N'-(2-methoxythiobenzoyl)pyridine-2-carbohydrazide], [Fe(L(2))(acac)], [Fe(HL(2))2 Cl]; [H2L(2) = N'-(4-methoxythiobenzoyl)pyridine-2-carbohydrazide] and [Fe(L(3)) (acac)]; [H2L(3) = N'-(2-hydroxythiobenzoyl)pyridine-2-carbohydrazide] were prepared by stirring/refluxing/mixing the respective ligand with FeCl3/Fe(acac)3 in chloroform/methanol. All the compounds were characterized by elemental analyses, magnetic susceptibility, IR, UV and Mossbauer spectral data. The complexes high/low spin state and have tetrahedral/octahedral geometry.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.
Resumo:
The solubility and uniform distribution of lanthanide complexes in sol-get glasses can be improved by covalently linking the complexes to the sol-gel matrix. In this study, several lanthanide beta-diketonate complexes (Ln = Nd, Sm, Eu, Tb, Er, Yb) were immobilized on a 1,10-phenanthroline functionalized sol-gel glass. For the europium(Ill) complex, a sol-gel material of diethoxydimethylsilane (DEDMS) with polymer-like properties was derived. For the other lanthanide complexes, the sol-gel glass was prepared by using a matrix of tetramethoxysilane (TMOS) and DEDMS. Both systems were prepared under neutral reaction conditions. High-resolution emission and excitation spectra were recorded. The luminescence lifetimes were measured. (c) 2004 Elsevier B.V. All rights reserved.
Resumo:
New air-stable ruthenium(II) complexes that contain the aryldiamine ligand [C6H3(CH2-NMe2)(2)-2,6](-) (NCN) are described. These complexes are [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(6)-C10H14)] (2; C10H14 = p-cymene = C6H4Me-Pr-i-4), [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(5)-C5H5)(PPh3)] (5), and their isomeric forms [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(6)-C10H14)] (3) and [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(5)-C5H5)(PPh3)] (6), respectively. Complex 2 has been prepared from the reaction of [Li(NCN)](2) with [RuCl2(eta(6)-C10H14)](2), whereas complex 5 has been prepared by the treatment of [RuCl{eta(3)-N,C,N-C6H3(CH2NMe2)(2)-2,6}(PPh3)] (4) with [Na(C5H5)](n). Both 2 and 5 are formally 18-electron ruthenium(II) complexes in which the monoanionic potentially tridentate coordinating ligand NCN is eta(2)-C,N-bonded, In solution (halocarbon solvent at room temperature or in aromatic solvents at elevated temperature), the intramolecular rearrangements of 2 and 5 afford complexes 3 and 6, respectively. This is a result of a shift of the metal-C-aryl bond from position-1 to position-3 on the aromatic ring of the NCN ligand. The mechanism of the isomerization is proposed to involve a sequence of intramolecular oxidative addition and reductive elimination reactions of both aromatic and aliphatic C-H bonds. This is based on results from deuterium labeling, spectroscopic studies, and some kinetic experiments. The mechanism is proposed to contain fully reversible steps in the case of 5, but a nonreversible step involving oxidative addition of a methyl NCH2-H bond in the case of 2. The solid-state structures of complexes 2, 3, 5, and 6 have been determined by single-crystal X-ray diffraction. A new dinuclear 1,4-phenylene-bridged bisruthenium(II) complex, [1,4-{RuCl(eta(6)-C10H14)}(2){C-6(CH2NMe2)(4)-2,3,5,6-C,N,C',N'}] (9) has also been prepared from the dianionic ligand [C-6(CH2NMe2)(4)-2,3,5,6](2-) (C2N4). The C2N4 ligand is in an eta(2)-C,N-eta(2)-C',N'-bis(bidentate) bonding mode. Compound 9 does not isomerize in solution (halocarbon solvent), presumably because of the absence of an accessible C-aryl-H bond. Complex 9 could not be isolated in an analytically pure form, probably because of its high sensitivity to air and very low solubility, which precludes recrystallization.
Resumo:
The new anionic functionalized aryldiamine ligands [2,6-(Me(2)NCH(2))(2)-4-R-C6H2](-) (R = Me(3)SiC=C, C6H5, Me(3)Si), formally derived from [2,6-(Me(2)NCH(2))(2)C6H3](-), have been prepared as their lithium compounds. The compound [Li{2,6-(Me(2)NCH(2))(2)-4-Ph-C6H2}](2) crystallizes in the monoclinic space group C2/c (no. 15) with a = 13.1225(5), b = 13.5844(7), c = 15.9859(12) Angstrom, beta = 105.329(5)degrees, V = 3264.0(3)Angstrom(3), Z = 4. The structure refinement converged to R(1) = 0.0374 for 2037 observed reflections [F-o>4 sigma(F-o)] and wR(2) = 0.0922 for 2560 unique data. The organolithium compounds have been used in transmetalation reactions to give the corresponding functionalized organoruthenium(II) complexes [Ru-II{2,6-(Me(2)NCH(2))(2)-4-R-C6H2}(terpy)]Cl-+(-) (terpy = 2,2';6',2 ''-terpyridine). The Ru-II species with R = HC = C has also been synthesized.
Resumo:
The monoanionic ligand [C6H3(CH(2)NMe(2))(2)-2,6](-), a potentially terdentate N,C,N bonding system, has been employed to synthesize a series of new ruthenium(II) complexes [Ru{C6H3(CH(2)NMe(2))(2)-2,6}X(L)] (L = PPh(3) X = Cl (2a), I (2b); L = norbornadiene (nbd), X = Cl (4), eta(1)-OSO2CF3 (5)) and [Ru{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6',2 ''-terpyridine)]Cl (3). X-ray crystal structures of 2b and 3-5 have been determined, in which the N,C,N coordination geometry with respect to the metal center is found to differ considerably. In each complex the aryldiamine ligand is terdentate, eta(3)-N,C,N-bonded as a six electron donor system. However, depending on the other ligands in the Ru(II) coordination sphere, this ligand demonstrates considerable flexibility in adopting coordination geometries which range from meridional in 3 through pseudomeridional in 2b to pseudofacial in 4 and 5. In the structures of 4 and 5 significant distortions of the aryl ring, involving bending of the six-membered ring into a boatlike conformation, are found. The different combinations of the N,C,N ligand with sets of other ligands lead to a range of metal geometries, i.e. square pyramidal in 2b, octahedral in 3, and bicapped tetrahedral in 4 and 5.