Rich task implementation: modernism meets postmodernism

School renewal', 'productive pedagogies', 'rich tasks', 'New Basics', 'key learning areas'--these are some of the discourses of change in selected Queensland schools. This paper will report on teaching as an insider/outsider in a school's Health and Physical Education department during a time of intense pressure for structural, curriculum and pedagogical shifts. As a teacher/researcher, I spent ten weeks in a government secondary school attempting to implement rich tasks as well as collect data using formal and informal interviews, field note, and document analyses, with a focus upon teachers', students' and administrators' sense of change processes and outcomes. It is suggested that the processes of, and barriers to, curriculum change in this context are best explained in terms of tensions between modernist and postmodernist phenomena.

Calcium is essential for the structural integrity of the cysteine-rich, ligand-binding repeat of the low-density lipoprotein receptor

Seven cysteine-rich repeats form the ligand-binding region of the low-density lipoprotein (LDL) receptor. Each of these repeats is assumed to bind a calcium ion, which is needed for association of the receptor with its ligands, LDL and beta-VLDL. The effects of metal ions on the folding of the reduced N-terminal cysteine-rich repeat have been examined by using reverse-phase high-performance liquid chromatography to follow the formation of fully oxidized isomers with different disulfide connectivities. in the absence of calcium many of the 15 possible isomers formed on oxidation, whereas in its presence the predominant product at equilibrium had the native disulfide bond connectivities. Other metals were far less effective at directing disulfide bond formation: Mn2+ partly mimicked the action of Ca2+, but Ba2+, Sr2+, and Mg2+ had little effect. This metal-ion specificity was also observed in two-dimensional H-1 NMR spectral studies: only Ca2+ induced the native three-dimensional fold. The two paramagnetic ions, Gd3+ and Mn2+, and Cd2+ did not promote adoption of a well-defined structure, and the two paramagnetic ions did not displace calcium ions. The location of calcium ion binding sites in the repeat was also explored by NMR spectroscopy. The absence of chemical shift changes for the side chain proton resonances of Asp26, Asp36, and Glu37 from pH 3.9 to 6.8 in the presence of calcium ions and their proximal location in the NMR structures implicated these side chains as calcium ligands. Deuterium exchange NMR experiments also revealed a network of hydrogen bonds that stabilizes the putative calcium-binding loop.

Inhibition of phenotype modulation, growth, and migration of vascular smooth muscle cells by a guanosine-rich 30-mer phosphorothioate oligodeoxynucleotide

The testing of a 30-mer dG-rich phosphorothioate oligodeoxynucleotide (LG4PS) for effects on the behaviour of vascular smooth muscle cells (VSMC) in vitro and in vivo is described. LG4PS at 0.3 mu M inhibited significantly the phenotype modulation of freshly isolated rabbit VSMC, and cell outgrowth from pig aortic explants was inhibited similar to 80% by 5 mu M LG4PS. The growth of proliferating rabbit and pig VSMC was inhibited similar to 70% by 0.3 mu M and 5 mu M LG4PS, respectively. Though less marked, the antiproliferative effects of LG4PS on human VSMC were comparable to those obtained with heparin. The cytotoxic effects of LG4PS on VSMC in vitro were low. Despite these promising results, adventitial application of 2-200 nmol LG4PS in pluronic gel failed to reduce vascular hyperplasia in balloon-injured rabbit carotid arteries, and the highest dose caused extensive mortality. (C) 1997 Academic Press Limited.

Emergence of multidrug-resistant tuberculosis in a community-based directly observed treatment programme in rural South Africa

OBJECTIVE: Although little studied in developing countries, multidrug-resistant tuberculosis (MDR-TB) is considered a major threat. We report the molecular epidemiology, clinical features and outcome of an emerging MDR-TB epidemic. METHODS: In 1996 all tuberculosis suspects in the rural Hlabisa district, South Africa, had sputum cultured, and drug susceptibility patterns of mycobacterial isolates were determined. Isolates with MDR-TB (resistant to both isoniazid and rifampicin) were DNA fingerprinted by restriction fragment length polymorphism (RFLP) using IS6110 and polymorphic guanine-cytosine-rich sequence-based (PGRS) probes. Patients with MDR-TB were traced to determine outcome. Data were compared with results from a survey of drug susceptibility done in 1994. RESULTS: The rate of MDR-TB among smear-positive patients increased six-fold from 0.36% (1/275) in 1994 to 2.3% (13/561) in 1996 (P = 0.04). A further eight smear-negative cases were identified in 1996 from culture, six of whom had not been diagnosed with tuberculosis. MDR disease was clinically suspected in only five of the 21 cases (24%). Prevalence of primary and acquired MDR-TB was 1.8% and 4.1%, respectively. Twelve MDR-TB cases (67%) were in five RFLP-defined clusters. Among 20 traced patients, 10 (50%) had died, five had active disease (25%) and five (25%) were apparently cured. CONCLUSIONS: The rate of MDR-TB has risen rapidly in Hlabisa, apparently due to both reactivation disease and recent transmission. Many patients were not diagnosed with tuberculosis and many were not suspected of drug-resistant disease, and outcome was poor.

Applications of NMR in drug design: Sructure-activity relationships in disulfide-rich peptides

NMR is a powerful technique for determining structures of biologically active molecules in solution. In recent years. our laboratory has focussed on the structure determination of small disulfide-rich proteins from both plants and animals which are valuable targets in drug design applications. This article will review these structural studies and their implications in drug design.

Compact stellar systems in the Fornax Cluster: Super-massive star clusters or extremely compact dwarf galaxies?

We describe a population of compact objects in the centre of the Fornax Cluster which were discovered as part of our 2dF Fornax Spectroscopic Survey. These objects have spectra typical of old stellar systems, but are unresolved on photographic sky survey plates. They have absolute magnitudes - 13 < M-B

Adoption of Strategic Alliances by Shoes Industries of the Vale do Rio dos Sinos-RS and Franca-SP clusters: an exploratory study

The new environment of the companies, result of the relative opening of the market caused by the globalization has set a new challenge to assure the continuity of the businesses. Competitive strategies have been implemented aiming to overcome such challenge and, amongst them, strategic alliances have shown to be a viable alternative. In this context, this article has as objective to investigate the degree of use of strategic alliances by the medium and large companies of the shoes industries located in clusters of Vale do Rio dos Sinos (RS) and Franca (SP). This exploratory and descriptive research had the participation of 54 companies, being 3 from Vale do Rio dos Sinos and 21 from Franca, which answered a questionnaire with closed questions. The analysis of the data was given through descriptive statistics. Main conclusions, follow as: (1) the majority of the companies have joint activities; (2) the companies are nearer to alliances that do business than to the strategic ones; (3) alliances with competitors are inexpressive - suppliers and customers predominate; (4) the control of alliances result is insufficient; (5) trust and adequate partner are determinative factors.

Dermaseptin 01 as antimicrobial peptide with rich biotechnological potential: study of peptide interaction with membranes containing Leishmania amazonensis lipid-rich extract and membrane models

This article addresses the interactions of the synthetic antimicrobial peptide dermaseptin 01 (GLWSTIKQKGKEAAIAAA-KAAGQAALGAL-NH(2), DS 01) with phospholipid (PL) monolayers comprising (i) a lipid-rich extract of Leishmania amazonensis (LRE-La), (ii) zwitterionic PL (dipalmitoylphosphatidylcholine, DPPC), and (iii) negatively charged PL (dipalmitoylphosphatidylglycerol, DPPG). The degree of interaction of DS 01 with the different biomembrane models was quantified from equilibrium and dynamic liquid-air interface parameters. At low peptide concentrations, interactions between DS 01 and zwitterionic PL, as well as with the LRE-La monolayers were very weak, whereas with negatively charged PLs the interactions were stronger. For peptide concentrations above 1 mu g/ml, a considerable expansion of negatively charged monolayers occurred. In the case of DPPC, it was possible to return to the original lipid area in the condensed phase, suggesting that the peptide was expelled from the monolayer. However, in the case of DPPG, the average area per lipid molecule in the presence of DS 01 was higher than pure PLs even at high surface pressures, suggesting that at least part of DS 01 remained incorporated in the monolayer. For the LRE-La monolayers, DS 01 also remained in the monolayer. This is the first report on the antiparasitic activity of AMPs using Langmuir monolayers of a natural lipid extract from L. amazonensis. Copyright (C) 2011 European Peptide Society and John Wiley & Sons, Ltd.

Geospatial clustering in data-rich environments: Features and issues

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Metabolic syndrome features small, apolipoprotein A-I-poor, triglyceride-rich HDL3 particles with defective anti-apoptotic activity

The metabolic syndrome (MetS) phenotype is typically characterized by visceral obesity, insulin resistance, atherogenic dyslipidemia involving hypertriglyceridemia and subnormal levels of high density lipoprotein-cholesterol (HDL-C), oxidative stress and elevated cardiovascular risk. The potent antioxidative activity of small HDL3 is defective in MetS [Hansel B, et al. J Clin Endocrinol Metab 2004;89:4963-71]. We evaluated the functional capacity of small HDL3 particles from MetS subjects to protect endothelial cells from apoptosis induced by mildly oxidized low-density lipoprotein (oxLDL). MetS subjects presented an insulin-resistant obese phenotype, with hypertriglyceridemia, elevated apolipoprotein B and insulin levels, but subnormal HDL-C concentrations and chronic low grade inflammation (threefold elevation of C-reactive protein). When human microvascular endothelial cells (HMEC-1) were incubated with oxLDL (200 jig apolipoprotein B/ml) in the presence or absence of control HDL subfiractions (25 mu g protein/ml), small, dense HDL3b and 3c significantly inhibited cellular annexin V binding and intracellular generation of reactive oxygen species. The potent anti-apoptotic activity of small HDL3c particles was reduced (-35%; p < 0.05) in MetS subjects (n = 16) relative to normolipidemic controls (n = 7). The attenuated anti-apoptotic activity of HDL3c correlated with abdominal obesity, atherogenic dyslipidemia and systemic oxidative stress (p < 0.05), and was intimately associated with altered physicochemical properties of apolipoprotein A-I (apoA-I-poor HDL3c, involving core cholesteryl ester depletion and triglyceride enrichment. We conclude that in MetS, apoA-I-poor, small, dense HDL3c exert defective protection of endothelial cells from oxLDL-induced apoptosis, potentially reflecting functional anomalies intimately associated with abnormal neutral lipid core content. (c) 2007 Elsevier Ireland Ltd. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).