A whole-genome scan for recurrent airway obstruction in Warmblood sport horses indicates two positional candidate regions

Recurrent airway obstruction (RAO), or heaves, is a naturally occurring asthma-like disease that is related to sensitisation and exposure to mouldy hay and has a familial basis with a complex mode of inheritance. A genome-wide scanning approach using two half-sibling families was taken in order to locate the chromosome regions that contribute to the inherited component of this condition in these families. Initially, a panel of 250 microsatellite markers, which were chosen as a well-spaced, polymorphic selection covering the 31 equine autosomes, was used to genotype the two half-sibling families, which comprised in total 239 Warmblood horses. Subsequently, supplementary markers were added for a total of 315 genotyped markers. Each half-sibling family is focused around a severely RAO-affected stallion, and the phenotype of each individual was assessed for RAO and related signs, namely, breathing effort at rest, breathing effort at work, coughing, and nasal discharge, using an owner-based questionnaire. Analysis using a regression method for half-sibling family structures was performed using RAO and each of the composite clinical signs separately; two chromosome regions (on ECA13 and ECA15) showed a genome-wide significant association with RAO at P < 0.05. An additional 11 chromosome regions showed a more modest association. This is the first publication that describes the mapping of genetic loci involved in RAO. Several candidate genes are located in these regions, a number of which are interleukins. These are important signalling molecules that are intricately involved in the control of the immune response and are therefore good positional candidates.

Killing of human melanoma cells induced by activation of class I interferon-regulated signaling pathways via MDA-7/IL-24.

Restoration of the tumor-suppression function by gene transfer of the melanoma differentiation-associated gene 7 (MDA7)/interleukin 24 (IL-24) successfully induces apoptosis in melanoma tumors in vivo. To address the molecular mechanisms involved, we previously revealed that MDA7/IL-24 treatment of melanoma cells down-regulates interferon regulatory factor (IRF)-1 expression and concomitantly up-regulates IRF-2 expression, which competes with the activity of IRF-1 and reverses the induction of IRF-1-regulated inducible nitric oxide synthase (iNOS). Interferons (IFNs) influence melanoma cell survival by modulating apoptosis. A class I IFN (IFN-alpha) has been approved for the treatment of advanced melanoma with some limited success. A class II IFN (IFN-gamma), on the other hand, supports melanoma cell survival, possibly through constitutive activation of iNOS expression. We therefore conducted this study to explore the molecular pathways of MDA7/IL-24 regulation of apoptosis via the intracellular induction of IFNs in melanoma. We hypothesized that the restoration of the MDA7/IL-24 axis leads to upregulation of class I IFNs and induction of the apoptotic cascade. We found that MDA7/IL-24 induces the secretion of endogenous IFN-beta, another class I IFN, leading to the arrest of melanoma cell growth and apoptosis. We also identified a series of apoptotic markers that play a role in this pathway, including the regulation of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and Fas-FasL. In summary, we described a novel pathway of MDA7/IL-24 regulation of apoptosis in melanoma tumors via endogenous IFN-beta induction followed by IRF regulation and TRAIL/FasL system activation.

Characterization of the inflammatory infiltrate and cytokine expression in the skin of horses with recurrent urticaria.

BACKGROUND Recurrent urticaria (RU) is a common skin disease of horses, but little is known about its pathogenesis. HYPOTHESIS/OBJECTIVE The aim of this study was to characterize the inflammatory cell infiltrate and cytokine expression pattern in the skin of horses with RU. ANIMALS   Biopsies of lesional and nonlesional skin of horses with RU (n = 8) and of skin from healthy control horses (n = 8) were evaluated. METHODS The inflammatory cell infiltrate was analysed by routine histology. Immunohistochemistry was used to identify T cells (CD3), B  ells (CD79), macrophages (MAC387) and mast cells (tryptase). Expression of T-helper 2 cytokines (interleukins IL-4, IL-5 and IL-13), a T-helper 1 cytokine (interferon-γ), IL-4 receptor α and thymic stromal lymphopoietin was assessed by quantitative RT-PCR. Results -  In subepidermal lesional skin of RU-affected horses, increased numbers of eosinophils (P ≤ 0.01), CD79-positive (P ≤ 0.01), MAC387-positive (P ≤ 0.01) and tryptase-positive cells (P ≤ 0.05) were found compared with healthy horses. Subepidermal lesional skin of RU-affected horses contained more eosinophils (P ≤ 0.05) and tryptase-positive cells (P ≤ 0.05) compared with nonlesional skin. There was no significant difference in infiltrating cells between nonlesional skin and skin of healthy horses. Expression of IL-4 (P ≤ 0.01), IL-13 (P ≤ 0.05), thymic stromal lymphopoietin (P ≤ 0.05) and IL-4 receptor α (P ≤ 0.05) was increased in lesional skin of RU-affected horses compared with control horses. Expression of IL-4 was higher (P ≤ 0.05) in lesional compared with nonlesional RU skin. CONCLUSIONS AND CLINICAL IMPORTANCE Analysis of cytokine expression and inflammatory infiltrate suggests that T-helper 2 cytokines, eosinophils, mast cells and presumptive macrophages play a role in the pathogenesis of equine RU.

Differential influence of maternal and fetal pregnancy factors on the in-vitro induction of human regulatory T cells: a preliminary study.

PROBLEM Given the important role of regulatory T cells (Treg) for successful pregnancy, the ability of soluble maternal and fetal pregnancy factors to induce human Treg was investigated. METHOD OF STUDY Peripheral blood mononuclear cells (PBMCs) or isolated CD4+CD25‒ cells were cultured in the presence of pooled second or third trimester pregnancy sera, steroid hormones or supernatants from placental explants, and the numbers and function of induced CD4+CD25+FOXP3+ Treg were analysed. RESULTS Third trimester pregnancy sera and supernatants of early placental explants, but not sex steroid hormones, induced an increase of Tregs from PBMCs. Early placental supernatant containing high levels of tumour necrosis factor-α, interferon-γ, interleukins -1, -6 and -17, soluble human leucocyte antigen-G, and transforming growth factor-β1, increased the proportion of Treg most effectively and was able to induce interleukin-10-secreting-Treg from CD4+CD25‒cells. CONCLUSIONS Compared with circulating maternal factors, placental- and fetal-derived factors appear to exert a more powerful effect on numerical changes of Treg, thereby supporting fetomaternal tolerance during human pregnancy.

The Function of Fish Cytokines

Peer reviewed

Preassembly of interleukin 2 (IL-2) receptor subunits on resting Kit 225 K6 T cells and their modulation by IL-2, IL-7, and IL-15: A fluorescence resonance energy transfer study

Assembly and mutual proximities of α, β, and γc subunits of the interleukin 2 receptors (IL-2R) in plasma membranes of Kit 225 K6 T lymphoma cells were investigated by fluorescence resonance energy transfer (FRET) using fluorescein isothiocyanate- and Cy3-conjugated monoclonal antibodies (mAbs) that were directed against the IL-2Rα, IL-2Rβ, and γc subunits of IL-2R. The cell-surface distribution of subunits was analyzed at the nanometer scale (2–10 nm) by FRET on a cell-by-cell basis. The cells were probed in resting phase and after coculture with saturating concentrations of IL-2, IL-7, and IL-15. FRET data from donor- and acceptor-labeled IL-2Rβ-α, γ-α, and γ-β pairs demonstrated close proximity of all subunits to each other in the plasma membrane of resting T cells. These mutual proximities do not appear to represent mAb-induced microaggregation, because FRET measurements with Fab fragments of the mAbs gave similar results. The relative proximities were meaningfully modulated by binding of IL-2, IL-7, and IL-15. Based on FRET analysis the topology of the three subunits at the surface of resting cells can be best described by a “triangular model” in the absence of added interleukins. IL-2 strengthens the bridges between the subunits, making the triangle more compact. IL-7 and IL-15 act in the opposite direction by opening the triangle possibly because they associate their private specific α receptors with the β and/or γc subunits of the IL-2R complex. These data suggest that IL-2R subunits are already colocalized in resting T cells and do not require cytokine-induced redistribution. This colocalization is significantly modulated by binding of relevant interleukins in a cytokine-specific manner.

Molecular cloning, sequence, expression, and processing of the interleukin 16 precursor

Interleukin 16 (IL-16) has been shown to function as chemoattractant factor, as a modulator of T-cell activation, and as an inhibitor of immunodeficiency virus replication. The recent identification of inconsistencies in published IL-16 cDNA nucleotide sequences led to the proposal that IL-16 is synthesized in the form of a large precursor protein (pro-IL-16). To identify the true transcriptional start of the IL-16 mRNA rapid amplification of cDNA ends methods were applied. The complete pro-IL-16 cDNA was subsequently molecularly cloned, sequenced, and expressed in COS-7 cells. We report here that pro-IL-16 is most likely synthesized as a 67-kDa protein and is encoded from a major 2.6-kb transcript. Recombinant pro-IL-16 polypeptides are specifically cleaved in lysates of CD8(+) cells, suggesting that the naturally secreted bioactive form of IL-16 is smaller than the originally published 130 amino acids fragment. Moreover, in contrast to other interleukins such as IL-15, IL-16 mRNA expression is almost exclusively limited to lymphatic tissues underlining the potential of IL-16 as an immune regulatory molecule.

The control of hematopoiesis and leukemia: from basic biology to the clinic.

Hematopoiesis gives rise to blood cells of different lineages throughout normal life. Abnormalities in this developmental program lead to blood cell diseases including leukemia. The establishment of a cell culture system for the clonal development of hematopoietic cells made it possible to discover proteins that regulate cell viability, multiplication and differentiation of different hematopoietic cell lineages, and the molecular basis of normal and abnormal blood cell development. These regulators include cytokines now called colony-stimulating factors (CSFs) and interleukins (ILs). There is a network of cytokine interactions, which has positive regulators such as CSFs and ILs and negative regulators such as transforming growth factor beta and tumor necrosis factor (TNF). This multigene cytokine network provides flexibility depending on which part of the network is activated and allows amplification of response to a particular stimulus. Malignancy can be suppressed in certain types of leukemic cells by inducing differentiation with cytokines that regulate normal hematopoiesis or with other compounds that use alternative differentiation pathways. This created the basis for the clinical use of differentiation therapy. The suppression of malignancy by inducing differentiation can bypass genetic abnormalities that give rise to malignancy. Different CSFs and ILs suppress programmed cell death (apoptosis) and induce cell multiplication and differentiation, and these processes of development are separately regulated. The same cytokines suppress apoptosis in normal and leukemic cells, including apoptosis induced by irradiation and cytotoxic cancer chemotherapeutic compounds. An excess of cytokines can increase leukemic cell resistance to cytotoxic therapy. The tumor suppressor gene wild-type p53 induces apoptosis that can also be suppressed by cytokines. The oncogene mutant p53 suppresses apoptosis. Hematopoietic cytokines such as granulocyte CSF are now used clinically to correct defects in hematopoiesis, including repair of chemotherapy-associated suppression of normal hematopoiesis in cancer patients, stimulation of normal granulocyte development in patients with infantile congenital agranulocytosis, and increase of hematopoietic precursors for blood cell transplantation. Treatments that decrease the level of apoptosis-suppressing cytokines and downregulate expression of mutant p53 and other apoptosis suppressing genes in cancer cells could improve cytotoxic cancer therapy. The basic studies on hematopoiesis and leukemia have thus provided new approaches to therapy.

Apoptosis of hemopoietic cells by the human granulocyte-macrophage colony-stimulating factor mutant E21R.

Human granulocyte-macrophage colony-stimulating factor (GM-CSF) binds to a high-affinity heterodimeric receptor composed of a specific alpha chain and a common beta chain (beta(c)), which is shared with the receptors for interleukins 3 and 5. Hemopoietic cell survival requires GM-CSF binding this high-affinity receptor. We have recently developed the GM-CSF mutant E21R, which selectively binds to the alpha chain and behaves as a competitive GM-CSF antagonist. We have now examined the role of E21R on the survival of hemopoietic cells and found that E21R causes apoptosis (programmed cell death) of normal and malignant cells directly in the absence of GM-CSF. The direct apoptotic effect of E21R occurred in a dose- and time-dependent manner. Apoptosis by E21R was dependent on cells expressing the high-affinity GM-CSF receptor and could be blocked by GM-CSF. Significantly, apoptosis of the cells occurred even in the presence of the survival factors granulocyte CSF and stem cell factor but was prevented by engagement of beta(c) with interleukin 3. The initiation of apoptosis required phosphorylation, transcriptional activity, and protein synthesis. These findings support a model whereby binding of E21R to the alpha chain leads to apoptosis, while beta(c) plays an important role in cell survival. This model may be applicable to other multimeric cytokine receptors and offers a novel approach for the treatment of human leukemia.

Cloning and characterization of a binding subunit of the interleukin 13 receptor that is also a component of the interleukin 4 receptor.

Interleukins 4 (IL-4) and 13 (IL-13) have been found previously to share receptor components on some cells, as revealed by receptor cross-competition studies. In the present study, the cloning is described of murine NR4, a previously unrecognized receptor identified on the basis of sequence similarity with members of the hemopoietin receptor family. mRNA encoding NR4 was found in a wide range of murine cells and tissues. By using transient expression in COS-7 cells, NR4 was found to encode the IL-13 receptor alpha chain, a low-affinity receptor capable of binding IL-13 but not IL-4 or interleukins 2, -7, -9, or -15. Stable expression of the IL-13 receptor alpha chain (NR4) in CTLL-2 cells resulted in the generation of high-affinity IL-13 receptors capable of transducing a proliferative signal in response to IL-13 and, moreover, led to competitive cross-reactivity in the binding of IL-4 and IL-13. These results suggest that the IL-13 receptor alpha chain (NR4) is the primary binding subunit of the IL-13 receptor and may also be a component of IL-4 receptors.

Structural basis for major histocompatibility complex (MHC)-linked susceptibility to autoimmunity: charged residues of a single MHC binding pocket confer selective presentation of self-peptides in pemphigus vulgaris.

Human T-cell-mediated autoimmune diseases are genetically linked to particular alleles of MHC class II genes. Susceptibility to pemphigus vulgaris (PV), an autoimmune disease of the skin, is linked to a rare subtype of HLA-DR4 (DRB1*0402, 1 of 22 known DR4 subtypes). The PV-linked DR4 subtype differs from a rheumatoid arthritis-associated DR4 subtype (DRB1*0404) only at three residues (DR beta 67, 70, and 71). The disease is caused by autoantibodies against desmoglein 3 (DG), and T cells are thought to trigger the autoantibody production against this keratinocyte adhesion molecule. Based on the DRB1*0402 binding motif, seven candidate peptides of the DG autoantigen were identified. T cells from four PV patients with active disease responded to one of these DG peptides (residues 190-204); two patients also responded to DG-(206-220). T-cell clones specific for DG-(190-204) secreted high levels of interleukins 4 and 10, indicating that they may be important in triggering the production of DG-specific autoantibodies. The DG-(190-204) peptide was presented by the disease-linked DRB1*0402 molecule but not by other DR4 subtypes. Site-directed mutagenesis of DRB1*0402 demonstrated that selective presentation of DG-(190-204), which carries a positive charge at the P4 position, was due to the negatively charged residues of the P4 pocket (DR beta 70 and 71). DR beta 71 has a negative charge in DRB1*0402 but a positive charge in other DR4 subtypes, including the DR4 subtypes linked to rheumatoid arthritis. The charge of the P4 pocket in the DR4 peptide binding site therefore appears to be a critical determinant of MHC-linked susceptibility to PV and rheumatoid arthritis.

Amyloid beta peptide potentiates cytokine secretion by interleukin-1 beta-activated human astrocytoma cells.

Neurodegenerative processes in Alzheimer disease (AD) are thought to be driven in part by the deposition of amyloid beta (A beta), a 39- to 43-amino acid peptide product resulting from an alternative cleavage of amyloid precursor protein. Recent descriptions of in vitro neurotoxic effects of A beta support this hypothesis and suggest toxicity might be mediated by A beta-induced neuronal calcium disregulation. In addition, it has been reported that "aging" A beta results in increased toxic potency due to peptide aggregation and formation of a beta-sheet secondary structure. In addition, A beta might also promote neuropathology indirectly by activating immune/inflammatory pathways in affected areas of the brain (e.g., cortex and hippocampus). Here we report that A beta can modulate cytokine secretion [interleukins 6 and 8 (IL-6 and IL-8)] from human astrocytoma cells (U-373 MG). Freshly prepared and aged A beta modestly stimulated IL-6 and IL-8 secretion from U-373 MG cells. However, in the presence of interleukin-1 beta (IL-1 beta), aged, but not fresh, A beta markedly potentiated (3- to 8-fold) cytokine release. In contrast, aged A beta did not potentiate substance P (NK-1)- or histamine (H1)-stimulated cytokine production. Further studies showed that IL-1 beta-induced cytokine release was potentiated by A beta-(25-35), while A beta-(1-16) was inactive. Calcium disregulation may be responsible for the effects of A beta on cytokine production, since the calcium ionophore A23187 similarly potentiated IL-1 beta-induced cytokine secretion and EGTA treatment blocked either A beta or A23187 activity. Thus, chronic neurodegeneration in AD-affected brain regions may be mediated in part by the ability of A beta to exacerbate inflammatory pathways in a conformation-dependent manner.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Control of proliferation in the rat thymus

Quiescent rat thymocytes were stimulated to divide by a variety of agents. One such mitogen was the neurotransmitter acetylcholine which exhibited a biphasic action. Interaction with low affinity nicotinic receptors was linked with an obligatory requirement for magnesium ions whereas combination with high affinity muscarinic receptors induced mitosis only if calcium ions were present in the medium. Binding of acetylcholine to its muscarinic receptor enhanced calcium influx and increased intracellular calcium levels causing calmodulin activation, a necessary prelude to DNA synthesis and mitosis. Nicotinic receptor activation may be associated with a magnesium influx and stimulation of cells in a calmodulin-independent fashion. Parathyroid hormone and its analogues exhibited only a monophasic mitogenic action. This response was linked to calcium influx, a rise in cytosolic calcium and calmodulin activation. Parathyroid hormone did not stimulate adenylate cyclase in thymocytes and decreased cellular cyclic AMP concentrations. Picomolar amounts of interleukin-2 (IL-2) also stimulated division in thymocytes derived from 3-month old rats by binding to high affinity receptors. The response in thymocytes from newborn and foetal animals was greater reflecting the larger proportion of cells bearing receptors at this age. The mitogenic effect of IL-2 was abolished by a monoclonal antibody directed against the IL-2 receptor. Injections of IL-2 itself or the administration of IL-2 secreting activated syngeneic spleen cells also stimulated proliferation of both thymus and bone marrow cells in vivo. Likewise immunisation with pertussis toxin, which enhances endogenous IL2 production, also increased mitosis in these tissues. Calcium influx, increased cytosolic Ca2+ levels and calmodulin activation are associated features of the mitogenic action of IL-2. Interleukin-1 was also found to be mitogenic in thymic lymphocyte cultures. The responses to this mitogen and to parathyroid hormone and acetylcholine were not inhibited by the anti-IL2 receptor antibody suggesting that the thymic lymphocyte bears discrete receptors for these agents. Subtle interactions of hormones, neurotransmitters and interleukins may thus contribute to the turnover and control of lymphoid cells in the thymus and perhaps bone-marrow.

Alexithymia and interleukin variations in somatoform disorder

Objective: The aim of the present study was to investigate if somatoform disorders (SFD) are associated with changes in the normal serum levels of important interleukins, and further, to establish if these changes are related to the presence and severity of alexithymia in patients with SFD. Methods: Twenty-four unmedicated patients who met the International Classification of Diseases (ICD-10) diagnostic criteria for SFD completed the psychological questionnaire to assess alexithymia (Toronto Alexithymia Scale), symptom reporting (SCL-90-R) and diagnostic criteria for SFD (Screening for Somatoform Symptoms scale). Serum concentrations of soluble interleukin 2 receptor α (sIL-2 Rα), IL-4, IL-6, IL-10 and IL-12 were determined in patients with SFD and in 9 healthy subjects. Results: In patients with SFD, serum levels of IL-6 (p < 0.001), IL-10 (p = 0.047) and immunoglobulin E (p = 0.045) were significantly increased in comparison with healthy controls. Additionally, a negative correlation was observed between the level of alexithymia ('total' Toronto Alexithymia Scale score) and the serum levels of sIL-2 Rα (r = -0.538) in SFD. Conclusions: Taken together, these results suggest that SFD, with clinically significant alexithymia, are associated with a reduction in Th1-mediated immune function and an increase in the activation of the Th2 immune function, indicated by the augmented serum levels of IL-6 and IL-10 and elevated immunoglobulin E. Copyright © 2007 S. Karger AG.