948 resultados para Growth-stimulating Factor
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Changes in blood dendritic cell (BDC) counts (CD123(hi)BDC and CD11c(+)BDC) and expression of CD62L, CCR7, and CD49d were analyzed in healthy donors, multiple myeloma (MM), and non-Hodgkin lymphoma (NHL) patients, who received granulocyte-colony stimulating factor (G-CSF) containing peripheral blood stem cell (PBSC) mobilization protocols. Low-dose G-CSF in healthy donors (8-10 mug/ kg/d subcutaneously) and high-dose G-CSF in patients (30 mug/kg/d) increased CD123(hi)BDC (2- to 22-fold, mean 3.7 x 10(6)/ L-17.7 x 10(6)/L and 1.9 x 10(6)/L-12.0 x 10(6)/ L) in healthy donors and MM but decreased CD11c(+)BDC (2- to 10-fold, mean 5.7 x 10(6)/L-1.6 x 10(6)/L) in NHL patients, on the day of apheresis, compared with steady state. After apheresis, CD123(hi)BDC counts remained high, whereas low CD11c(+)BDC counts tended to recover in the following 2-5 days. Down-regulation of CD62L and up-regulation of CCR7 on CD123(hi)BDC were found in most healthy donors and MM patients. CD49d expression was unchanged. Thus, PBSC mobilization may change BDC counts by altering molecules necessary for BDC homing from blood into tissues.
Resumo:
Despite more than a 10-fold increase in T cell numbers in G-CSF-mobilized peripheral blood stem cell (PBSC) grafts, incidence and severity of acute graft-vs-host disease (GVHD) are comparable to bone marrow transplantation. As CD1d-restricted, Valpha24(+)Vbeta11(+) NKT cells have pivotal immune regulatory functions and may influence GVHD, we aimed to determine whether G-CSF has any effects on human NKT cells. In this study, we examined the frequency and absolute numbers of peripheral blood NKT cells in healthy stem cell donors (n = 8) before and following G-CSF (filgrastim) treatment. Effects of in vivo and in vitro G-CSF on NKT cell cytokine expression profiles and on responsiveness of NKT cell subpopulations to specific stimulation by alpha-galactosylceramide (alpha-GalCer) were assessed. Contrary to the effects on conventional T cells, the absolute number of peripheral blood NKT cells was unaffected by G-CSF administration. Furthermore, responsiveness of NKT cells to alpha-GalCer stimulation was significantly decreased (p < 0.05) following exposure to G-CSF in vivo. This hyporesponsiveness was predominantly due to a direct effect on NKT cells, with a lesser contribution from G-CSF-mediated changes in APC. G-CSF administration resulted in polarization of NKT cells toward a Th2, IL-4-secreting phenotype following alpha-GalCer stimulation and preferential expansion of the CD4(+) NKT cell subset. We conclude that G-CSF has previously unrecognized differential effects in vivo on NKT cells and conventional MHC-restricted T cells, and effects on NKT cells may contribute to the lower than expected incidence of GVHD following allogeneic peripheral blood stem cell transplantation.
Resumo:
The use of granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral blood as a source of stem cells has resulted in a high incidence of severe chronic graft-versus-host disease (cGVHD), which compromises the outcome of clinical allogeneic stem cell transplantation. We have studied the effect of G-CSF on both immune complex and fibrotic cGVHD directed to major (DBA/2 --> B6D2F1) or minor (B10.D2 --> BALB/c) histocompatibility antigens. In both models, donor pretreatment with G-CSF reduced cGVHD mortality in association with type 2 differentiation. However, after escalation of the donor T-cell dose, scleroderma occurred in 90% of the recipients of grafts from G-CSF-treated donors. In contrast, only 11% of the recipients of control grafts developed scleroderma, and the severity of hepatic cGVHD was also reduced. Mixing studies confirmed that in the presence of high donor T-cell doses, the severity of scleroderma was determined by the non-T-cell fraction of grafts from G-CSF-treated donors. These data confirm that the induction of cGVHD after donor treatment with G-CSF is dependent on the transfer of large numbers of donor T cells in conjunction with a putatively expanded myeloid lineage, providing a further rationale for the limitation of cell dose in allogeneic stem cell transplantation. (C) 2004 American Society for Blood and Marrow Transplantation.
Resumo:
Expression of the mouse transcription factor EC (Tfec) is restricted to the myeloid compartment, suggesting a function for Tfec in the development or function of these cells. However, mice lacking Tfec develop normally, indicating a redundant role for Tfec in myeloid cell development. We now report that Tfec is specifically induced in bone marrow-derived macrophages upon stimulation with the Th2 cytokines, IL-4 and IL-13, or LPS. LPS induced a rapid and transient up-regulation of Tfec mRNA expression and promoter activity, which was dependent on a functional NF-kappa B site. IL-4, however, induced a rapid, but long-lasting, increase in Tfec mRNA, which, in contrast to LPS stimulation, also resulted in detectable levels of Tfec protein. IL-4-induced transcription of Tfec was absent in macrophages lacking Stat6, and its promoter depended on two functional Stat6-binding sites. A global comparison of IL-4-induced genes in both wild-type and Tfec mutant macrophages revealed a surprisingly mild phenotype with only a few genes affected by Tfec deficiency. These included the G-CSFR (Csf3r) gene that was strongly up-regulated by IL-4 in wild-type macrophages and, to a lesser extent, in Tfec mutant macrophages. Our study also provides a general definition of the transcriptome in alternatively activated mouse macrophages and identifies a large number of novel genes characterizing this cell type.
Resumo:
Context: Genes from the ovarian bone morphogenetic signaling pathway (GDF9 and BMP15) are critical for normal human fertility. We previously identified a deletion mutation in GDF9 in sisters with spontaneous dizygotic (DZ) twins, but the prevalence of rare GDF9 variants in twinning families is unknown. Objective: The objective was to evaluate the frequency of rare variants in GDF9 in families with a history of DZ twinning. Design and Subjects: We recruited 3450 individuals from 915 DZ twinning families (1693 mothers of twins) and 1512 controls of Caucasian origin. One mother of DZ twins was selected from 279 of the 915 families, and a DNA sample was screened for rare variants in GDF9 using denaturant HPLC. Variants were confirmed by DNA sequencing and genotyped in the entire sample by matrix-assisted laser desorption ionization time of flight (MALDI-TOF) mass spectrometry. Results: We found two novel insertion/deletions (c.392-393insT, c.1268-1269delAA) and four missense alterations in the GDF9 sequence in mothers of twins. Two of the missense variants (c.307C > T, p.Pro103Ser and c.362C > T, p.Thr121Leu) were located in the proregion of GDF9 and two (c.1121C > T, p.Pro374Leu and c.1360C > T, p.Arg454Cys) in the mature protein region. For each variant, the frequencies were higher in cases compared with controls. The proportion of mothers of DZ twins carrying any variant (4.12%) was significantly higher (P < 0.0001) than the proportion of carriers in controls (2.29%). Conclusion: We describe new variants in the GDF9 gene that are significantly more common in mothers of DZ twins than controls, suggesting that rare GDF9 variants contribute to the likelihood of DZ twinning.
Resumo:
Unidirectional hybridization between bluegill (Lepomis macrochirus) and pumpkinseed (L. gibbosus) sunfish enables researchers to explore the relative expression of paternal and maternal alleles in hybrids. Past studies have found that the metabolic dysfunction in bluegill-pumpkinseed hybrids may be due to incompatibilities between nuclear and mitochondrial genomes. However, the consequences of hybridization on body size and muscle growth have not been examined. This topic is particularly interesting because hybrids grow larger than parentals despite the fact that they are often sired by smaller, precociously mature bluegills. In order to improve our understanding of growth dynamics in hybrid sunfish, I conducted real-time quantitative PCR using species-specific primers on the white muscle tissue of bluegills, pumpkinseeds, and hybrids collected from Lake Opinicon, ON. Five growth factors that have been linked to muscle growth and body size demonstrated similar expression for maternal and paternal alleles. While about half of the hybrids showed the same pattern with myogenin, about half showed very low levels of mRNA for the paternal (bluegill) gene. While this did not explain the heterosis seen in hybrids, it may explain the small body phenotype of the cuckholding bluegill males. I explored the upstream genetic structure of bluegill myogenin and established that four alleles exist within the population. Furthermore, I uncovered a relationship in hybrids between the proximal promoter/ 5’ UTR of myogenin and its transcript level. I found that the hybrids demonstrating low paternal myogenin expression unfailingly possessed A3 or A4 alleles, but future studies will be needed to reveal the molecular links between the genotype and the growth phenotype. A similar genotype-phenotype association was not obvious in parentals, even those that were homozygous for these alleles. Whether this relationship can provide insight into the genetic determinants of bluegill alternative mating strategies has yet to be determined.
Resumo:
Background and Purpose - Loss of motor function is common after stroke and leads to significant chronic disability. Stem cells are capable of self-renewal and of differentiating into multiple cell types, including neurones, glia, and vascular cells. We assessed the safety of granulocyte-colony-stimulating factor (G-CSF) after stroke and its effect on circulating CD34 stem cells. Methods - We performed a 2-center, dose-escalation, double-blind, randomized, placebo-controlled pilot trial (ISRCTN 16784092) of G-CSF (6 blocks of 1 to 10 g/kg SC, 1 or 5 daily doses) in 36 patients with recent ischemic stroke. Circulating CD34 stem cells were measured by flow cytometry; blood counts and measures of safety and functional outcome were also monitored. All measures were made blinded to treatment. Results - Thirty-six patients, whose mean SD age was 768 years and of whom 50% were male, were recruited. G-CSF (5 days of 10 g/kg) increased CD34 count in a dose-dependent manner, from 2.5 to 37.7 at day 5 (area under curve, P0.005). A dose-dependent rise in white cell count (P0.001) was also seen. There was no difference between treatment groups in the number of patients with serious adverse events: G-CSF, 7/24 (29%) versus placebo 3/12 (25%), or in their dependence (modified Rankin Scale, median 4, interquartile range, 3 to 5) at 90 days. Conclusions - ”G-CSF is effective at mobilizing bone marrow CD34 stem cells in patients with recent ischemic stroke. Administration is feasible and appears to be safe and well tolerated. The fate of mobilized cells and their effect on functional outcome remain to be determined. (Stroke. 2006;37:2979-2983.)
Resumo:
Background Granulocyte-colony stimulating factor (G-CSF) shows promise as a treatment for stroke. This systematic review assesses G-CSF in experimental ischaemic stroke. Methods Relevant studies were identified with searches of Medline, Embase and PubMed. Data were extracted on stroke lesion size, neurological outcome and quality, and analysed using Cochrane Review Manager using random effects models; results are expressed as standardised mean difference (SMD) and odds ratio (OR). Results Data were included from 19 publications incorporating 666 animals. G-CSF reduced lesion size significantly in transient (SMD -1.63, p<0.00001) but not permanent (SMD -1.56, p=0.11) focal models of ischaemia. Lesion size was reduced at all doses and with treatment commenced within 4 hours of transient ischaemia. Neurological deficit (SMD -1.37, p=0.0004) and limb placement (SMD -1.88, p=0.003) improved with G-CSF; however, locomotor activity (>4 weeks post ischaemia) was not (SMD 0.76, p=0.35). Death (OR 0.27, p<0.0001) was reduced with G-CSF. Median study quality was 4 (range 0-7/8); Egger’s test suggested significant publication bias (p=0.001). Conclusions G-CSF significantly reduced lesion size in transient but not permanent models of ischaemic stroke. Motor impairment and death were also reduced. Further studies assessing dose-response, administration time, length of ischaemia and long-term functional recovery are needed.
Resumo:
T-cell based vaccines against human immunodeficiency virus (HIV) generate specific responses that may limit both transmission and disease progression by controlling viral load. Broad, polyfunctional, and cytotoxic CD4+ T-cell responses have been associated with control of simian immunodeficiency virus/HIV-1 replication, supporting the inclusion of CD4+ T-cell epitopes in vaccine formulations. Plasmid-encoded granulocyte-macrophage colony-stimulating factor (pGM-CSF) co-administration has been shown to induce potent CD4+ T-cell responses and to promote accelerated priming and increased migration of antigen-specific CD4+ T-cells. However, no study has shown whether co-immunisation with pGM-CSF enhances the number of vaccine-induced polyfunctional CD4+ T-cells. Our group has previously developed a DNA vaccine encoding conserved, multiple human leukocyte antigen (HLA)-DR binding HIV-1 subtype B peptides, which elicited broad, polyfunctional and long-lived CD4+ T-cell responses. Here, we show that pGM-CSF co-immunisation improved both magnitude and quality of vaccine-induced T-cell responses, particularly by increasing proliferating CD4+ T-cells that produce simultaneously interferon-γ, tumour necrosis factor-α and interleukin-2. Thus, we believe that the use of pGM-CSF may be helpful for vaccine strategies focused on the activation of anti-HIV CD4+ T-cell immunity.
Resumo:
The Posttraumatic Growth Inventory (PTGI) is frequently used to assess positive changes following a traumatic event. The aim of the study is to examine the factor structure and the latent mean invariance of PTGI. A sample of 205 (M age = 54.3, SD = 10.1) women diagnosed with breast cancer and 456 (M age = 34.9, SD = 12.5) adults who had experienced a range of adverse life events were recruited to complete the PTGI and a socio-demographic questionnaire. We use Confirmatory Factor Analysis (CFA) to test the factor-structure and multi-sample CFA to examine the invariance of the PTGI between the two groups. The goodness of fit for the five-factor model is satisfactory for breast cancer sample (χ2(175) = 396.265; CFI = .884; NIF = .813; RMSEA [90% CI] = .079 [.068, .089]), and good for non-clinical sample (χ2(172) = 574.329; CFI = .931; NIF = .905; RMSEA [90% CI] = .072 [.065, .078]). The results of multi-sample CFA show that the model fit indices of the unconstrained model are equal but the model that uses constrained factor loadings is not invariant across groups. The findings provide support for the original five-factor structure and for the multidimensional nature of posttraumatic growth (PTG). Regarding invariance between both samples, the factor structure of PTGI and other parameters (i.e., factor loadings, variances, and co-variances) are not invariant across the sample of breast cancer patients and the non-clinical sample.
Resumo:
The molecular mechanisms behind the entry of the primordial follicle into the growing follicle pool remain poorly understood. To investigate this process further, a microarray-based comparison was undertaken between 2-day postpartum mouse ovaries consisting of primordial follicles/naked oocytes only and those with both primordial follicles and newly activated follicles (7-day postpartum). Gene candidates identified included the chemoattractive cytokine stromal derived factor-1 (SDF1) and its receptor CXCR4. SDF1 and CXCR4 have been implicated in a variety of physiological processes including the migration of embryonic germ cells to the gonads. SDF1-alpha expression increased with the developmental stage of the follicle. Embryonic expression was found to be dichotomous post-genii cell migration, with low expression in the female. Immunohistochemical studies nonetheless indicate that the autocrine pattern of expression ligand and receptor begins during embryonic life. Addition of recombinant SDF1-alpha to neonatal mouse ovaries in vitro resulted in significantly higher follicle densities than for control ovaries. TUNEL analysis indicated no detectable difference in populations of apoptotic cells of treated or control ovaries. Treated ovaries also contained a significantly lower percentage of activated follicles as determined by measurement of oocyte diameter and morphological analysis. Treatment of cultured ovaries with an inhibitor of SDF1-alpha, AMD3100, ablated the effect of SDF1-alpha. By retaining follicles in an unactivated state, SDF1/CXCR4 signaling may play an important role in maintaining the size and longevity of the primordial follicle pool. (c) 2006 Elsevier Inc. All rights reserved.