Surface collective oscillations of metal clusters and spheres: Random-phase-approximation sum-rules approach

Using the once and thrice energy-weighted moments of the random-phase-approximation strength function, we have derived compact expressions for the average energy of surface collective oscillations of clusters and spheres of metal atoms. The L=0 volume mode has also been studied. We have carried out quantal and semiclassical calculations for Na and Ag systems in the spherical-jellium approximation. We present a rather thorough discussion of surface diffuseness and quantal size effects on the resonance energies.

Spin and density longitudinal response of quantum dots in the time-dependent local-spin-density approximation

The longitudinal dipole response of a quantum dot has been calculated in the far-infrared regime using local-spin-density-functional theory. We have studied the coupling between the collective spin and density modes as a function of the magnetic field. We have found that the spin dipole mode and single-particle excitations have a sizable overlap, and that the magnetoplasmon modes can be excited by the dipole spin operator if the dot is spin polarized. The frequency of the dipole spin edge mode presents an oscillation which is clearly filling factor (v) related. We have found that the spin dipole mode is especially soft for even-n values. Results for selected numbers of electrons and confining potentials are discussed.

Spin polarized neutron matter and magnetic susceptibility within the Brueckner-Hartree-Fock approximation

The Brueckner-Hartree-Fock formalism is applied to study spin polarized neutron matter properties. Results of the total energy per particle as a function of the spin polarization and density are presented for two modern realistic nucleon-nucleon interactions, Nijmegen II and Reid93. We find that the dependence of the energy on the spin polarization is practically parabolic in the full range of polarizations. The magnetic susceptibility of the system is computed. Our results show no indication of a ferromagnetic transition which becomes even more difficult as the density increases.

An operator formulation of the multiscale finite-volume method with correction function

The multiscale finite-volume (MSFV) method has been derived to efficiently solve large problems with spatially varying coefficients. The fine-scale problem is subdivided into local problems that can be solved separately and are coupled by a global problem. This algorithm, in consequence, shares some characteristics with two-level domain decomposition (DD) methods. However, the MSFV algorithm is different in that it incorporates a flux reconstruction step, which delivers a fine-scale mass conservative flux field without the need for iterating. This is achieved by the use of two overlapping coarse grids. The recently introduced correction function allows for a consistent handling of source terms, which makes the MSFV method a flexible algorithm that is applicable to a wide spectrum of problems. It is demonstrated that the MSFV operator, used to compute an approximate pressure solution, can be equivalently constructed by writing the Schur complement with a tangential approximation of a single-cell overlapping grid and incorporation of appropriate coarse-scale mass-balance equations.

On the tractability of the piecewise-linear approximation for general discrete-choice network revenue management

The choice network revenue management (RM) model incorporates customer purchase behavioras customers purchasing products with certain probabilities that are a function of the offeredassortment of products, and is the appropriate model for airline and hotel network revenuemanagement, dynamic sales of bundles, and dynamic assortment optimization. The underlyingstochastic dynamic program is intractable and even its certainty-equivalence approximation, inthe form of a linear program called Choice Deterministic Linear Program (CDLP) is difficultto solve in most cases. The separation problem for CDLP is NP-complete for MNL with justtwo segments when their consideration sets overlap; the affine approximation of the dynamicprogram is NP-complete for even a single-segment MNL. This is in contrast to the independentclass(perfect-segmentation) case where even the piecewise-linear approximation has been shownto be tractable. In this paper we investigate the piecewise-linear approximation for network RMunder a general discrete-choice model of demand. We show that the gap between the CDLP andthe piecewise-linear bounds is within a factor of at most 2. We then show that the piecewiselinearapproximation is polynomially-time solvable for a fixed consideration set size, bringing itinto the realm of tractability for small consideration sets; small consideration sets are a reasonablemodeling tradeoff in many practical applications. Our solution relies on showing that forany discrete-choice model the separation problem for the linear program of the piecewise-linearapproximation can be solved exactly by a Lagrangian relaxation. We give modeling extensionsand show by numerical experiments the improvements from using piecewise-linear approximationfunctions.

Molecular characterization of the processing of arenavirus envelope glycoprotein precursors by subtilisin kexin isozyme-1/site-1 protease.

A crucial step in the life cycle of arenaviruses is the biosynthesis of the mature fusion-active viral envelope glycoprotein (GP) that is essential for virus-host cell attachment and entry. The maturation of the arenavirus GP precursor (GPC) critically depends on proteolytic processing by the cellular proprotein convertase (PC) subtilisin kexin isozyme-1 (SKI-1)/site-1 protease (S1P). Here we undertook a molecular characterization of the SKI-1/S1P processing of the GPCs of the prototypic arenavirus lymphocytic choriomeningitis virus (LCMV) and the pathogenic Lassa virus (LASV). Previous studies showed that the GPC of LASV undergoes processing in the endoplasmic reticulum (ER)/cis-Golgi compartment, whereas the LCMV GPC is cleaved in a late Golgi compartment. Herein we confirm these findings and provide evidence that the SKI-1/S1P recognition site RRLL, present in the SKI-1/S1P prodomain and LASV GPC, but not in the LCMV GPC, is crucial for the processing of the LASV GPC in the ER/cis-Golgi compartment. Our structure-function analysis revealed that the cleavage of arenavirus GPCs, but not cellular substrates, critically depends on the autoprocessing of SKI-1/S1P, suggesting differences in the processing of cellular and viral substrates. Deletion mutagenesis showed that the transmembrane and intracellular domains of SKI-1/S1P are dispensable for arenavirus GPC processing. The expression of a soluble form of the protease in SKI-I/S1P-deficient cells resulted in the efficient processing of arenavirus GPCs and rescued productive virus infection. However, exogenous soluble SKI-1/S1P was unable to process LCMV and LASV GPCs displayed at the surface of SKI-I/S1P-deficient cells, indicating that GPC processing occurs in an intracellular compartment. In sum, our study reveals important differences in the SKI-1/S1P processing of viral and cellular substrates.

Amplitude envelope synchronization in coupled chaotic oscillators.

A peculiar type of synchronization has been found when two Van der PolDuffing oscillators, evolving in different chaotic attractors, are coupled. As the coupling increases, the frequencies of the two oscillators remain different, while a synchronized modulation of the amplitudes of a signal of each system develops, and a null Lyapunov exponent of the uncoupled systems becomes negative and gradually larger in absolute value. This phenomenon is characterized by an appropriate correlation function between the returns of the signals, and interpreted in terms of the mutual excitation of new frequencies in the oscillators power spectra. This form of synchronization also occurs in other systems, but it shows up mixed with or screened by other forms of synchronization, as illustrated in this paper by means of the examples of the dynamic behavior observed for three other different models of chaotic oscillators.

Analytical Dirac-Hartree-Fock-Slater screening function for atoms (Z=1-92)

An analytical approximation, depending on five parameters, for the atomic screening function is proposed. The corresponding electrostatic potential takes a simple analytical form (superposition of three Yukawa potentials) well suited to most practical applications. Parameters in the screening function, determined by an analytical fitting procedure to Dirac-Hartree-Fock-Slater (DHFS) self-consistent data, are given for Z=1¿92. The reliability of this analytical approach is demonstrated by showing that (a) Born cross sections for elastic scattering of fast charged particles by the present analytical field and by the DHFS field practically coincide and (b) one-electron binding energies computed from the independent-particle model with our analytical field (corrected for exchange and electrostatic self-interaction) agree closely with the DHFS energy eigenvalues.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

The FCLT with Dependent Errors: an Helicopter Tour of the Quality of the Approximation

This note investigates the adequacy of the finite-sample approximation provided by the Functional Central Limit Theorem (FCLT) when the errors are allowed to be dependent. We compare the distribution of the scaled partial sums of some data with the distribution of the Wiener process to which it converges. Our setup is purposely very simple in that it considers data generated from an ARMA(1,1) process. Yet, this is sufficient to bring out interesting conclusions about the particular elements which cause the approximations to be inadequate in even quite large sample sizes.

L'Approximation diophantienne simultanée et l'optimisation discrète

Étant donnée une fonction bornée (supérieurement ou inférieurement) $f:\mathbb{N}^k \To \Real$ par une expression mathématique, le problème de trouver les points extrémaux de $f$ sur chaque ensemble fini $S \subset \mathbb{N}^k$ est bien défini du point de vu classique. Du point de vue de la théorie de la calculabilité néanmoins il faut éviter les cas pathologiques où ce problème a une complexité de Kolmogorov infinie. La principale restriction consiste à définir l'ordre, parce que la comparaison entre les nombres réels n'est pas décidable. On résout ce problème grâce à une structure qui contient deux algorithmes, un algorithme d'analyse réelle récursive pour évaluer la fonction-coût en arithmétique à précision infinie et un autre algorithme qui transforme chaque valeur de cette fonction en un vecteur d'un espace, qui en général est de dimension infinie. On développe trois cas particuliers de cette structure, un de eux correspondant à la méthode d'approximation de Rauzy. Finalement, on établit une comparaison entre les meilleures approximations diophantiennes simultanées obtenues par la méthode de Rauzy (selon l'interprétation donnée ici) et une autre méthode, appelée tétraédrique, que l'on introduit à partir de l'espace vectoriel engendré par les logarithmes de nombres premiers.

Spin and density longitudinal response of quantum dots in the time-dependent local-spin-density approximation

The longitudinal dipole response of a quantum dot has been calculated in the far-infrared regime using local-spin-density-functional theory. We have studied the coupling between the collective spin and density modes as a function of the magnetic field. We have found that the spin dipole mode and single-particle excitations have a sizable overlap, and that the magnetoplasmon modes can be excited by the dipole spin operator if the dot is spin polarized. The frequency of the dipole spin edge mode presents an oscillation which is clearly filling factor (v) related. We have found that the spin dipole mode is especially soft for even-n values. Results for selected numbers of electrons and confining potentials are discussed.

Spin polarized neutron matter and magnetic susceptibility within the Brueckner-Hartree-Fock approximation

The Brueckner-Hartree-Fock formalism is applied to study spin polarized neutron matter properties. Results of the total energy per particle as a function of the spin polarization and density are presented for two modern realistic nucleon-nucleon interactions, Nijmegen II and Reid93. We find that the dependence of the energy on the spin polarization is practically parabolic in the full range of polarizations. The magnetic susceptibility of the system is computed. Our results show no indication of a ferromagnetic transition which becomes even more difficult as the density increases.

Convergence Rates of Approximation by Translates

In this paper we consider the problem of approximating a function belonging to some funtion space Φ by a linear comination of n translates of a given function G. Ussing a lemma by Jones (1990) and Barron (1991) we show that it is possible to define function spaces and functions G for which the rate of convergence to zero of the erro is 0(1/n) in any number of dimensions. The apparent avoidance of the "curse of dimensionality" is due to the fact that these function spaces are more and more constrained as the dimension increases. Examples include spaces of the Sobolev tpe, in which the number of weak derivatives is required to be larger than the number of dimensions. We give results both for approximation in the L2 norm and in the Lc norm. The interesting feature of these results is that, thanks to the constructive nature of Jones" and Barron"s lemma, an iterative procedure is defined that can achieve this rate.

Carbon suboxide: the vibrational dependence of the v7 bending potential function

Data on the vibrational energy levels and rotational constants of carbon suboxide for the low-wavenumber bending mode ν7 are reviewed, in the ground-state manifold, and in the ν2-, ν3-, ν4-, and ν2 + ν4-state manifolds. Following the procedure developed by Duckett, Mills, and Robiette [J. Mol. Spectrosc. 63, 249 (1976)] the data have been inverted to give the effective bending potential in ν7 for each of these five states. Values are obtained for various other parameters in the effective vibration-rotation Hamiltonian. The potential and rotational constants in ν2 + ν4 are given to a close approximation by linear extrapolation from the ground state through the ν2 and ν4 states.