Phylogenetic structures of the Holarctic Sorex araneus group and its relationships with S-samniticus, as inferred from mtDNA sequences

The shrews of the Sorex araneus group, characterized by the sexual chromosome complex XY1, Y2 have been intensively studied by morphological, karyotypical, and biochemical analyses. Nevertheless, the phylogenetic relationships among the species belonging to the araneus complex are still under debate, as different approaches gave often contradictory results. In this paper, partial nucleotide sequences of the mitochondrial DNA cytochrome b gene (1011 bp) were determined for 6 species of the araneus group from Eurasia and North America. We also included in the data set the sequences of Sorex samniticus, whose relationships with the araneus group remain controversial. Three other species representing two major karyological groups were also examined. Both parsimony and distance trees strongly support the monophyly of the araneus group. Sorex sumniticus is significantly more closely related to the araneus complex than to the other species included in the analysis. Based on the branching pattern within the araneus group, an attempt has been made to reconstruct the colonization history of the Holarctic region.

Protein-protein interactions between adenovirus DNA polymerase and nuclear factor I mediate formation of the DNA replication preinitiation complex.

The in vitro adenovirus (Ad) DNA replication system provides an assay to study the interaction of viral and host replication proteins with the DNA template in the formation of the preinitiation complex. This initiation system requires in addition to the origin DNA sequences 1) Ad DNA polymerase (Pol), 2) Ad preterminal protein (pTP), the covalent acceptor for protein-primed DNA replication, and 3) nuclear factor I (NFI), a host cell protein identical to the CCAAT box-binding transcription factor. The interactions of these proteins were studied by coimmunoprecipitation and Ad origin DNA binding assays. The Ad Pol can bind to origin sequences only in the presence of another protein which can be either pTP or NFI. While NFI alone can bind to its origin recognition sequence, pTP does not specifically recognize DNA unless Ad Pol is present. Thus, protein-protein interactions are necessary for the targetting of either Ad Pol or pTP to the preinitiation complex. DNA footprinting demonstrated that the Ad DNA site recognized by the pTP.Pol complex was within the first 18 bases at the end of the template which constitutes the minimal origin of replication. Mutagenesis studies have defined the Ad Pol interaction site on NFI between amino acids 68-150, which overlaps the DNA binding and replication activation domain of this factor. A putative zinc finger on the Ad Pol has been mutated to a product that fails to bind the Ad origin sequences but still interacts with pTP. These results indicate that both protein-protein and protein-DNA interactions mediate specific recognition of the replication origin by Ad DNA polymerase.

Proof of concept for microarray-based detection of DNA-binding oncogenes in cell extracts.

The function of DNA-binding proteins is controlled not just by their abundance, but mainly at the level of their activity in terms of their interactions with DNA and protein targets. Moreover, the affinity of such transcription factors to their target sequences is often controlled by co-factors and/or modifications that are not easily assessed from biological samples. Here, we describe a scalable method for monitoring protein-DNA interactions on a microarray surface. This approach was designed to determine the DNA-binding activity of proteins in crude cell extracts, complementing conventional expression profiling arrays. Enzymatic labeling of DNA enables direct normalization of the protein binding to the microarray, allowing the estimation of relative binding affinities. Using DNA sequences covering a range of affinities, we show that the new microarray-based method yields binding strength estimates similar to low-throughput gel mobility-shift assays. The microarray is also of high sensitivity, as it allows the detection of a rare DNA-binding protein from breast cancer cells, the human tumor suppressor AP-2. This approach thus mediates precise and robust assessment of the activity of DNA-binding proteins and takes present DNA-binding assays to a high throughput level.

Experimental analysis and computer prediction of CTF/NFI transcription factor DNA binding sites.

Accurate prediction of transcription factor binding sites is needed to unravel the function and regulation of genes discovered in genome sequencing projects. To evaluate current computer prediction tools, we have begun a systematic study of the sequence-specific DNA-binding of a transcription factor belonging to the CTF/NFI family. Using a systematic collection of rationally designed oligonucleotides combined with an in vitro DNA binding assay, we found that the sequence specificity of this protein cannot be represented by a simple consensus sequence or weight matrix. For instance, CTF/NFI uses a flexible DNA binding mode that allows for variations of the binding site length. From the experimental data, we derived a novel prediction method using a generalised profile as a binding site predictor. Experimental evaluation of the generalised profile indicated that it accurately predicts the binding affinity of the transcription factor to natural or synthetic DNA sequences. Furthermore, the in vitro measured binding affinities of a subset of oligonucleotides were found to correlate with their transcriptional activities in transfected cells. The combined computational-experimental approach exemplified in this work thus resulted in an accurate prediction method for CTF/NFI binding sites potentially functioning as regulatory regions in vivo.

DNA methylation by CcrM activates the transcription of two genes required for the division of Caulobacter crescentus.

DNA methylation regulates many processes, including gene expression, by superimposing secondary information on DNA sequences. The conserved CcrM enzyme, which methylates adenines in GANTC sequences, is essential to the viability of several Alphaproteobacteria. In this study, we find that Caulobacter crescentus cells lacking the CcrM enzyme accumulate low levels of the two conserved FtsZ and MipZ proteins, leading to a severe defect in cell division. This defect can be compensated by the expression of the ftsZ gene from an inducible promoter or by spontaneous suppressor mutations that promote FtsZ accumulation. We show that CcrM promotes the transcription of the ftsZ and mipZ genes and that the ftsZ and mipZ promoter regions contain a conserved CGACTC motif that is critical to their activities and to their regulation by CcrM. In addition, our results suggest that the ftsZ promoter has the lowest activity when the CGACTC motif is non-methylated, an intermediate activity when it is hemi-methylated and the highest activity when it is fully methylated. The regulation of ftsZ expression by DNA methylation may explain why CcrM is essential in a subset of Alphaproteobacteria.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Validation of real-time methylation-specific PCR to determine O6-methylguanine-DNA methyltransferase gene promoter methylation in glioma.

Epigenetic silencing of the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) by promoter methylation predicts successful alkylating agent therapy, such as with temozolomide, in glioblastoma patients. Stratified therapy assignment of patients in prospective clinical trials according to tumor MGMT status requires a standardized diagnostic test, suitable for high-throughput analysis of small amounts of formalin-fixed, paraffin-embedded tumor tissue. A direct, real-time methylation-specific PCR (MSP) assay was developed to determine methylation status of the MGMT gene promoter. Assay specificity was obtained by selective amplification of methylated DNA sequences of sodium bisulfite-modified DNA. The copy number of the methylated MGMT promoter, normalized to the beta-actin gene, provides a quantitative test result. We analyzed 134 clinical glioma samples, comparing the new test with the previously validated nested gel-based MSP assay, which yields a binary readout. A cut-off value for the MGMT methylation status was suggested by fitting a bimodal normal mixture model to the real-time results, supporting the hypothesis that there are two distinct populations within the test samples. Comparison of the tests showed high concordance of the results (82/91 [90%]; Cohen's kappa = 0.80; 95% confidence interval, 0.82-0.95). The direct, real-time MSP assay was highly reproducible (Pearson correlation 0.996) and showed valid test results for 93% (125/134) of samples compared with 75% (94/125) for the nested, gel-based MSP assay. This high-throughput test provides an important pharmacogenomic tool for individualized management of alkylating agent chemotherapy.

Photocontrolled DNA Binding of a Receptor-Targeted Organometallic Ruthenium(II) Complex

A photoactivated ruthenium(II) arene complex has been conjugated to two receptor-binding peptides, a dicarba analogue of octreotide and the Arg-Gly-Asp (RGD) tripeptide. These peptides can act as"tumor-targeting devices" since their receptors are overexpressed on the membranes of tumor cells. Both ruthenium-peptide conjugates are stable in aqueous solution in the dark, but upon irradiation with visible light, the pyridyl-derivatized peptides were selectively photodissociated from the ruthenium complex, as inferred by UV-vis and NMR spectroscopy. Importantly, the reactive aqua species generated from the conjugates, [(η6-p-cym)Ru(bpm)(H2O)]2+, reacted with the model DNA nucleobase 9-ethylguanine as well as with guanines of two DNA sequences, 5′dCATGGCT and 5′dAGCCATG. Interestingly, when irradiation was performed in the presence of the oligonucleotides, a new ruthenium adduct involving both guanines was formed as a consequence of the photodriven loss of p-cymene from the two monofunctional adducts. The release of the arene ligand and the formation of a ruthenated product with a multidentate binding mode might have important implications for the biological activity of such photoactivated ruthenium(II) arene complexes. Finally, photoreactions with the peptide-oligonucleotide hybrid, Phac-His-Gly-Met-linker-p5′dCATGGCT, also led to arene release and to guanine adducts, including a GG chelate. The lack of interaction with the peptide fragment confirms the preference of such organometallic ruthenium(II) complexes for guanine over other potential biological ligands, such as histidine or methionine amino acids.

The role of MAR elements in DNA recombination

The untargeted integration of foreign DNA into the mammalian cell genome, extensively used in gene therapy and biotechnology, remains an incompletely understood process. It is believed to be based on cellular DNA double strand break (DSB) repair machinery and to involve two major steps: i) the formation of long gene arrays (concatemers), and ii) recombination of the resulting concatemer with the genome. The main DSB repair pathways in eukaryotes include non-homologous end-joining (NHEJ), homologous recombination (HR), and microhomology-mediated end-joining (MMEJ). However, it is still not clear, which of these pathways are responsible for transgene integration. Here, we show that NHEJ is not the primary pathway used by mammalian cells in the transgene integration process, while the components of the HR pathway seem to be important for genomic integration but not concatemerization. Instead, concatemer formation appears to be mediated by a subset of the MMEJ pathway, termed synthesis-dependent MMEJ (SD-MMEJ). This mechanism also seems to be preferentially used for plasmid integration into the genome, as confirmed by the analysis of plasmid-to-genome junction sequences, which were found to display an SD-MMEJ pattern. Therefore, we propose the existence of two distinct SD-MMEJ subpathways, relying on different subsets of enzymes. One of these mechanisms appears to be responsible for concatemerization, while the other mechanism, partially dependent in HR enzymes, seems to mediate recombination with the genome. Previous studies performed by our group suggested that matrix attachment regions (MARs), which are epigenetic regulatory DNA elements that participate in the formation of chromatin boundaries and augment transcription, may mediate increased plasmid integration into the genome of CHO cells by stimulating DNA recombination. In the present work, we demonstrate that MAR-mediated plasmid integration results from the enhanced SD-MMEJ pathway. Analysis of transgene integration loci and junction DNA sequences validated the prevalent use of this pathway by the MAR elements to target plasmid DNA into gene-rich areas of the CHO genome. We propose that this finding should in the future help to engineer cells for improved recombinant protein production. In addition to investigating the process of transgene integration, we designed recombination assays to better characterize the components of the MMEJ and SD-MMEJ pathways. We also used CHO cells expressing cycle-sensitive reporter genes to demonstrate a potential role of HR proteins in the cell cycle regulation.

Phylogenetic relationships of Apodemus Kaup, 1829 (Rodentia: Muridae) species in the Eastern Mediterranean inferred from mitochondrial DNA, with emphasis on iranian species

Wood mice of the genus Apodemus are widely distributed in Eurasia, with the Eastern Mediterranean being considered as a hotspot. Indeed, numerous species have been documented in Iran, including A. witherbyi, A. hyrcanicus, A. uralensis, A. avicennicus, A. hermonensis, and A. arianus. In this study, 129 specimens were collected from different Iranian localities and two specimens from Afghanistan. The animals were identified taxonomically and their phylogenetic relationships were investigated using cytochrome b mitochondrial DNA sequences. Five species of the genus Apodemus were identified in Iran, including A. hyrcanicus, A. witherbyi, A. cf. ponticus, A. uralensis, and A. mystacinus, beside, A. pallipes from Afghanistan. This study found no evidence of A. flavicollis or A. sylvaticus in Iran, despite their occurrence in Turkey, shedding doubt on the status of A. flavicollis in Iran, Asia Minor, and the Levant. Phylogenetic analyses imply that A. witherbyi has priority over A. avicennicus, A. hermonensis, and A. iconicus. Estimation of the divergence time for these taxa suggests a separation at around 7.2 Ma for the subgenera Karstomys (including A. mystacinus and A. epimelas) and Sylvaemus (including A. flavicollis, A. sylvaticus, A. uralensis, A. pallipes, A. hyrcanicus, A. witherbyi, and A. cf. ponticus). Within the subgenus Karstomys, the divergence times for A. mystacinus and A. epimelas were between 3.0 and 6.1 Ma, and divergence times within the subgenus Sylvaemus were between 5.2 and 6.9 Ma for A. witherbyi and other species in this subgenus. It is postulated that vicariance events including the uplifting of the Zagros Mountains and Anatolian Plateau in the middle Miocene and climate oscillations during the Messinian Salinity Crisis besides formation of the Hyrcanian tertiary forests during the Neogene probably played substantial roles in the radiation and distribution of the genus Apodemus in the Eastern Mediterranean.

Fragmentation of contaminant and endogenous DNA in ancient samples determined by shotgun sequencing; prospects for human palaeogenomics

Despite the successful retrieval of genomes from past remains, the prospects for human palaeogenomics remain unclear because of the difficulty of distinguishing contaminant from endogenous DNA sequences. Previous sequence data generated on high-throughput sequencing platforms indicate that fragmentation of ancient DNA sequences is a characteristic trait primarily arising due to depurination processes that create abasic sites leading to DNA breaks.

Occurrence of virulence-related sequences and phylogenetic analysis of commensal and pathogenic avian Escherichia coli strains (APEC)

The presence of iron uptake (irp-2, fyuA, sitA, fepC, iucA), adhesion (iha, lpfA O157/O141, lpfA O157/O154, efa, toxB) and invasion (inv, ial-related DNA sequences and assignment to the four main Escherichia coli phylogenetic groups (A, B1, B2 e D) were determined in 30 commensal E. coli strains isolated from healthy chickens and in 49 APEC strains isolated from chickens presenting clinical signs of septicemia (n=24) swollen head syndrome (n=14) and omphalitis (n=11) by PCR. None of the strains presented DNA sequences related to the inv, ial, efa, and toxB genes. DNA sequences related to lpfA O157/O154, iucA, fepC, and irp-2 genes were significantly found among pathogenic strains, where iucA gene was associated with septicemia and swollen head syndrome and fepC and irp-2 genes were associated with swollen head syndrome strains. Phylogenetic typing showed that commensal and omphalitis strains belonged mainly to phylogenetic Group A and swollen head syndrome to phylogenetic Group D. Septicemic strains were assigned in phylogenetic Groups A and D. These data could suggest that clonal lineage of septicemic APEC strains have a multiple ancestor origin; one from a pathogenic bacteria ancestor and other from a non-pathogenic ancestor that evolved by the acquisition of virulence related sequences through horizontal gene transfer. Swollen head syndrome may constitute a pathogenic clonal group. By the other side, omphalitis strains probably constitute a non-pathogenic clonal group, and could cause omphalitis as an opportunistic infection. The sharing of virulence related sequences by human pathogenic E. coli and APEC strains could indicate that APEC strains could be a source of virulence genes to human strains and could represent a zoonotic risk.

A 28-fold increase in secretory protein synthesis is associated with DNA puff activity in the salivary gland of Bradysia hygida (Diptera, Sciaridae)

When the first group of DNA puffs is active in the salivary gland regions S1 and S3 of Bradysia hygida larvae, there is a large increase in the production and secretion of new salivary proteins demonstrable by [3H]-Leu incorporation. The present study shows that protein separation by SDS-PAGE and detection by fluorography demonstrated that these polypeptides range in molecular mass from about 23 to 100 kDa. Furthermore, these proteins were synthesized mainly in the S1 and S3 salivary gland regions where the DNA puffs C7, C5, C4 and B10 are conspicuous, while in the S2 region protein synthesis was very low. Others have shown that the extent of amplification for DNA sequences that code for mRNA in the DNA puffs C4 and B10 was about 22 and 10 times, respectively. The present data for this group of DNA puffs are consistent with the proposition that gene amplification is necessary to provide some cells with additional gene copies for the production of massive amounts of proteins within a short period of time (Spradling AC and Mahowald AP (1980) Proceedings of the National Academy of Sciences, USA, 77: 1096-1100).

Construction of bovine adenovirus type 3 E1 and E3, substitution plasmids and the sequencing analysis of DNA pol and pTP /

The relative ease to concentrate and purify adenoviruses, their well characterized mid-sized genome, and the ability to delete non-essential regions from their genome to accommodate foreign gene, made adenoviruses a suitable candidate for the construction of vectors. The use of adenoviral vectors in gene therapy, vaccination, and as a general vector system for expressing foreign genes have been documented for some time. In this study, the objective was to rescue a BAV3 E1 or E3 recombinant vector carrying the kanamycin resistant gene, a dominant selectable marker with useful applications in studying vectored gene expression in mammalian cells. To accomplish the objective of this study, more information about BAV3 DNA sequences was required in order to make the manipulation of the virus genome accessible. Therefore, sequencing of the BAV3 genome from 1 1 .7% to 30.8% was carried out. Analysis of the determined sequences revealed the primary structure of important viral gene products coded by E2 including BAV3 DNA pol and precursor to terminal protein. Comparative analysis of these proteins with their counterparts from human and non human adenoviruses revealed important insights as to the evolutionary lineage of BAV3. In order to insert the kanamycin resistance gene in either E1 or E3, it was necessary to delete BAV3 sequences to accommodate the foreign gene so as not to exceed the limit of the packaging capacity of the virus. To construct a recombinant BAV3 in which a foreign gene was inserted in the deleted E1 region, an E1 shuttle vector was constructed. This involved the deletion from the viral sequences a region between 1.3% to 9% and inserting the kanamycin resistance gene to replace the deletion. The E1 shuttle vector contained the left (0%- 53.9%) segment of the genome and was expected to generate BAV3 recombinants that can be grown and propagated in cells that can complement the missing E1 functions. To construct a similar shuttle vector for E3 deletion, DNA sequences extending from 78.9% to 82.5% (1281 bp) were deleted from within the E3 region that had been cloned into a plasmid vector. The deleted region corresponds to those that have been shown to be non-essential for viral replication in cell culture. The resulting plasmid was used to construct another recombinant plasmid with BAV3 DNA sequences extending from 37.1% to 100% and with a deletion of E3 sequences that were replaced by kanamycin resistance gene. This shuttle plasmid was used in cotransfections with digested viral DNA in an attempt to rescue a recombinant BAV3 carrying the kanamycin resistance gene to replace the deleted E3. In spite of repeated attempts of transfection, El or E3 recombinant BAV3 were not isolated. It seems that other approaches should be applied to make a final conclusion on BAV3 infectivity.

Factors affecting DNA uptake by mammalian cells

The ability to introduce DNA and express custom DNA sequences in bacteria opened the door for improvements in a large number of fields including agriculture, pharmacology, medicine, nutrition, etc. The ability to introduce foreign DNA sequences into mammalian cells in an efficient manner would have a large impact on therapeutic applications especially gene therapy. The methods in use today suffer from low efficiencies and sometimes toxicity. In this work a number of factors were evaluated for their effect onONA uptake efficiency. The factors studied included exposure to sublethal concentration of hydrogen peroxide which have been show to lead to destabilisation ofthe lysosomes. These exposures have proven to be very toxic to cells when combined with either the calcium phosphate or the lipofectAMINE® transfection methods. Another factor evaluated was exposure to Electro-Magnetic Fields (EMF). This was fuelled by the fact that EMF have been shown to mediate a number of effects on cell structure and/or physiology. EMF exposure by itself was not sufficient to induce the cells to pick up the DNA, therefore its effect on calcium phosphate and lipofectAMINE® was tested. Although some positive results were obtained, the variability of these results exceeded by far any observed enhancements which discouraged any further work on EMF. Also tested was the possible effect the presence of the cytomegalovirus (CMV) sequence might have on DNA uptake (based on previous results in this lab). It was found that the presence ofCMV in the DNA sequence does not enhance uptake or slow down degradation of the internalised DNA. The final factor tested was the effect of basic amino acids on transfection efficiency. It was found that arginine can enhance DNA uptake by about 170% v/ith calcium phosphate and about 200% with LipofectAMINE®. A model was proposed to explain the effect of arginine as well as the lack of effect from other amino acids.