981 resultados para DNA Fragment Assembly
Resumo:
The retrovirus HTLV-1 is the etiological agent of the adult T-cell leukemia and HTLV-1 associated myelopathy/tropical spastic paraparesis. The proviral genome has 9,032 base pairs, showing regulatory and structural genes. The env gene encodes for the transmembrane glycoprotein gp 21. The development of methodologies for heterologous protein expression, as well as the acquisition of a cellular line that constituently expresses the recombinant, were the main goals of this work. The DNA fragment that encodes for gp 21 was amplified by nested-PCR and cloned into a pCR2.1-TOPO vector. After which, a sub-cloning was realized using the expressing vector pcDNA3.1+. The transfection of mammalian cells HEK 293 was performed transitorily and permanently. Production of the recombinant gp 21 was confirmed by flux cytometry experiments and the cell line producing protein will be used in immunogenicity assays.
Resumo:
Cysticercosis is one of the most important zoonosis, not only because of the effects on animal health and its economic consequences, but also due to the serious danger it poses to humans. The two main parasites involved in the taeniasis-cysticercosis complex in Brazil are Taenia saginata and Taenia solium. Differentiating between these two parasites is important both for disease control and for epidemiological studies. The purpose of this work was to identify genetic markers that could be used to differentiate these parasites. Out of 120 oligonucleotide decamers tested in random amplified polymorphic DNA (RAPD) assays, 107 were shown to discriminate between the two species of Taenia. Twenty-one DNA fragments that were specific for each species of Taenia were chosen for DNA cloning and sequencing. Seven RAPD markers were converted into sequence characterized amplified region (SCAR) markers with two specific for T. saginata and five specific for T. solium as shown by agarose gel electrophoresis. These markers were developed as potential tools to differentiate T. solium from T. saginata in epidemiological studies. © 2007 Elsevier Inc. All rights reserved.
Resumo:
Nuclear mitochondrial-like sequences (numts) are copies of mitochondrial DNA that have migrated to the genomic DNA. We present the first characterization of numts in ants, these numts being homologues to a mitochondrial DNA fragment containing loci the 3′ portion of the cytochrome oxidase I gene, an intergenic spacer, the tRNA leucine gene and the 5′ portion of the cytochrome oxidase II gene. All 67 specimens of Atta cephalotes (Hymenoptera: Formicidae: Attini) investigated had these homologues, which are within two monophyletic groups that we called numt1 and numt2. Numt1 and numt2 sequences are less variable than mitochondrial sequences and released from the severe purifying selection constraining the evolution of mitochondrial genes. Their formation probably involved bottlenecks related to two distinct transfer events of ancient and fast evolving mitochondrial DNA fragments to comparative slowly evolving nuclear DNA regions. © 2007 The Authors.
Resumo:
A PCR-RFLP analysis of the restriction pattern in nuclear (RAG2) and mitochondrial (12S/16S) gene sequences of bat species from the Molossidae, Phyllostomidae, Vespertilionidae, and Emballonuridae families produced a large number of fragments: 107 for RAG2 and 155 for 12S/16S combined in 139 and 402 haplotypes, respectively. The values detected for gene variation were low for both sequences (0.13 for RAG2 and 0.15 for 12S/16S) and reflected their conservative feature, reinforced by high values of inter- and intraspecies genetic identity (70-100%). The species with a high gene divergence were variable in the analyses of RAG2 (Eumops perotis, Artibeus lituratus, and Carollia perspicillata) and of 12S/16S (Nyctinomops laticaudatus, C. perspicillata, and Cynomops abrasus), and furthermore, one of them, C. perspicillata, also showed the highest intraspecific variation. The species that exhibited the lowest variation for both genes was Molossus rufus. In the families, the highest variation was observed in the Molossidae and this can be attributed to variation exhibited by Eumops and Nyctinomops species. The variations observed were interpreted as a natural variability within the species and genus that exhibited a conserved pattern in the two gene sequences in different species and family analyzed. Our data reinforce the idea that the analyses of mitochondrial and nuclear genes contribute to our knowledge of the diversity of New World bats. The genetic variability found in different taxa suggests that an additional diversity, unnoticed by other methods, can be revealed with the use of different molecular strategies. ©FUNPEC-RP.
Resumo:
The objective of this study was to investigate morphological variation in traits of systematic relevance and the phylogenetic position, ecology, and reproductive biology of the shrimp Lysmata rauli Laubenheimer and Rhyne, 2010 (Caridea: Hippolytidae), described based only on a single specimen collected in Salvador, Bahia, Brazil. We analyzed a total of 89 specimens from Camamu Bay, Bahia (n = 88) and from S3o Vicente estuary, São Paulo (n = 1). Considerable morphological variation was detected in the rostral spine series, number of segments on the carpus and merus of pereiopod 2, number of spiniform setae on the ventrolateral margin of merus and on the ventral margin of propodus of pereiopods 3-5. Importantly, L rauli can be distinguished neither using morphology, nor coloration from the Indo-Pacific L. vittata (Stimpson, 1860). Furthermore, molecular phylogenetic analyses (using the 16S mt DNA fragment) did not reveal any considerable genetic dissimilarities between L rauli and L vittata. Thus, our results clearly indicate that L rauli is not a new species but a junior synonym of L vittata. The high density observed within the structures of oyster farming indicates that the invasive L vittata lives in crowds in Brazil. The studied population was composed of males, hermaphrodites, and transitional individuals (having characteristics of males and hermaphrodites). The above information suggests that L rauli is a protandric simultaneous hermaphrodite, as it has been observed in all species of Lysmata that have been investigated. Lysmata vittata has invaded the southwestern Atlantic and is present in Bahia, Rio de Janeiro and S3o Paulo, Brazil. © The Crustacean Society, 2013. Published by Brill NV, Leiden.
Resumo:
Supernumerary chromosomes (B chromosomes) occur in approximately 15% of eukaryote species. Although these chromosomes have been extensively studied, knowledge concerning their specific molecular composition is lacking in most cases. The accumulation of repetitive DNAs is one remarkable characteristic of B chromosomes, and the occurrence of distinct types of multigene families, satellite DNAs and some transposable elements have been reported. Here, we describe the organization of repetitive DNAs in the A complement and B chromosome system in the grasshopper species Abracris flavolineata using classical cytogenetic techniques and FISH analysis using probes for five multigene families, telomeric repeats and repetitive C0t-1 DNA fractions. The 18S rRNA and H3 histone multigene families are highly variable and well distributed in A. flavolineata chromosomes, which contrasts with the conservation of U snRNA genes and less variable distribution of 5S rDNA sequences. The H3 histone gene was an extensively distributed with clusters occurring in all chromosomes. Repetitive DNAs were concentrated in C-positive regions, including the pericentromeric region and small chromosomal arms, with some occurrence in C-negative regions, but abundance was low in the B chromosome. Finally, the first demonstration of the U2 snRNA gene in B chromosomes in A. flavolineata may shed light on its possible origin. These results provide new information regarding chromosomal variability for repetitive DNAs in grasshoppers and the specific molecular composition of B chromosomes. © 2013 Bueno et al.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
A high incidence of plants with mosaic, chlorotic spots, ringspots, necrosis, smaller leaves, and stunting was observed on peanut crops (Arachis hypogaea L.) in Itapolis, So Paulo State, Brazil. Transmission electron microscope examination of thin sections of infected leaves revealed the presence of spheroidal particles, ca. 80 nm in diameter, suggestive of Tospovirus. A DNA fragment of similar to 600 bp was amplified by RT-PCR from total RNA extracted from infected tissues using primers specific for the nucleocapsid gene of Groundnut ringspot virus (GRSV). Nucleotide and deduced amino acid sequences of the fragments showed high identities with known GRSV isolates.
Resumo:
Pós-graduação em Ciência Animal - FMVA
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Leaves of Cassia hoffmannseggii, a wild fabaceous species found in the Atlantic Forest, with a severe mosaic symptom were collected in Pernambuco State, Brazil. By transmission electron microscopy, two types of virus particles were found: the first was recognized as particles of a potyvirus, which was later identified as Cowpea aphid-borne mosaic virus; and the second was isometric and present in high concentration. The observation of vesicles at the periphery of chloroplasts suggested a tymovirus infection, which was confirmed by subsequent assays. A serological assay against several tymovirus antisera resulted in positive reaction of this tymo-like virus with an antiserum of Passion fruit yellow mosaic virus. By means of RT-PCR and using degenerated primers for the conserved region of RNA-dependent RNA polymerase (RdRp) gene of tymoviruses, a specific DNA fragment was amplified and sequenced. Based on this sequence, a specific forward primer was synthesized and successfully used to amplify the 3' terminal genome region, containing the partial RdRp gene and the complete coat protein (CP) sequences. The CP was 188 amino acids (aa) long, and the highest CP aa identity was observed with Kennedya yellow mosaic virus (61 %). Based on the current ICTV demarcation criterion, this isolate was considered as a distinct tymovirus and tentatively named as Cassia yellow mosaic-associated virus.
Production of human factor VIII-FL in 293T cells using the bicistronic MGMT(P140K)-retroviral vector
Resumo:
Hemophilia A is the most common X-linked bleeding disorder; it is caused by deficiency of coagulation factor VIII (FVIII). Replacement therapy with rFVIII produced from human cell line is a major goal for treating hemophilia patients. We prepared a full-length recombinant FVIII (FVIII-FL), using the pMFG-P140K retroviral vector. The IRES DNA fragment was cloned upstream to the P140K gene, providing a 9.34-kb bicistronic vector. FVIII-FL cDNA was then cloned upstream to IRES, resulting in a 16.6-kb construct. In parallel, an eGFP control vector was generated, resulting in a 10.1-kb construct. The 293T cells were transfected with these constructs, generating the 293T-FVIII-FL/P140K and 293T-eGFP/P140K cell lines. In 293T-FVIII-FL/P140K cells, FVIII and P140K mRNAs levels were 4,410 (+/- 931.7)- and 295,400 (+/- 75,769)-fold higher than in virgin cells. In 293T-eGFP/P140K cells, the eGFP and P140K mRNAs levels were 1,501,000 (+/- 493,700)- and 308,000 (+/- 139,300)-fold higher than in virgin cells. The amount of FVIII-FL was 0.2 IU/mL and 45 ng/mL FVIII cells or 4.4 IU/mu g protein. These data demonstrate the efficacy of the bicistronic retroviral vector expressing FVIII-FL and MGMT(P140K), showing that it could be used for producing the FVIII-FL protein in a human cell line.