Detecção de co-infecções por Leishmania (l.) chagasi, Trypanosoma evansi, Toxoplasma gondii e Neospora caninum em cães

Co-infections by Leishmania (L.) chagasi, Trypanosoma evansi, Toxoplasma gondii and Neospora caninum in dogs were investigated. Amastigotes forms of Leishmania spp. were detected by cytopathological analysis of lymph nodes in 46,42% (39/84) of dogs. In a male dog, adult, without defined breed, from rural area and positive for Leishmania, were observed flagellated forms of T. evansi in blood smear. By immunofluorescence antibody test, 5,95% (5/84) of dogs were considered reactive to T. gondii, with titer equal to or higher than 1:64, while 3,57% (3/84) were reactive to N. caninum, with titer ≥1:50. Among the animals with visceral leishmaniasis, one showed positive serological response to T. gondii and two for N. caninum. All dogs reactive to N. caninum were from rural area and the predominance of infection by T. gondii was in dogs from urban area. A young male dog from the rural area and seropositive for T. gondii showed Ehrlichia spp. morulae in the cytology and positive reaction for canine distemper virus. Thus, further studies are needed to assess the epidemiology of these infections in canine population, especially with respect to the reservoirs of Trypanosoma spp. in rural areas.

Photophysical properties of a fluorene-bipyridine copolymer and its complexes with europium

The synthesis and structural characterization of a europium complexed fluorene-bipyridine copolymer are described. A level of ion insertion of 80% in molar basis was achieved, and theoretical calculations showed that it required a twist of 179 degrees (49 kJ) between the pyridine units. Spectroscopy data showed that no electronic coupling between the main backbone and the complexation sites had occurred, but these hindered the interchain aggregation observed in the non complexed polymer. Preliminary electroluminescence studies showed that the EL and PL spectra are consistent, and that the ion had a trapping effect in the charge transport. (C) 2011 Elsevier B.V. All rights reserved.

Correlations between Conjugation Length, Macromolecular Dynamics, and Photophysics of Phenylene-Vinylene/Aliphatic Multiblock Copolymers

This work reports a detailed spectroscopy study of a series of multiblock conjugated nonconjugated copolymers built by p-phenylene vinylene type units (PV) and octamethylene spacers, namely, poly(1,8-octanedioxy-2,6-dimethoxy-1,4-phenylene-1,2-ethenylene) (LaPPS18). The relative proportions of the PV and aliphatic segments were estimated on the basis of solid-state NMR and Raman spectroscopy. The overall structure was characterized by wide angle X-ray diffraction; H-1 wide-line dipolar chemical shift correlation (DIPSHIFT), and centerband-only detection of exchange (CODEX) NMR data, that together with glass transition temperatures allowed us to identify the groups involved in the molecular dynamics. These different structural properties were used to explain the photoluminescence properties in terms of peak position and spectral profile

Photo- and electroluminescence in a series of PPV type terpolymers containing fluorene, thiophene and phenylene units

The emissive properties of terpolymers with fluorene, thiophene and phenylene groups, forming alternating PPV type structures, are discussed in terms of their composition, photo- and electroluminescence properties. The fluorene groups were inserted in each phenylene-vinylene and thiophene-vinylene units, and their concentration did not vary, representing 50% of the molar composition. The ratio of thiophene-vinylene/phenylene-vinylene varied in the range 25,50 and 75%. Photo- and electroluminescence properties were strongly dependent on the thiophene-vinylene content and were compared with the fluorene-vinylene-thiophene and fluorene-vinylene-phenylene parent copolymers. (C) 2012 Elsevier B.V. All rights reserved.

Photophysical and photovoltaic properties of a PPV type copolymer containing alternated fluorene and thiophene units

The synthesis and photophysical characterization of a PPV-type copolymer containing a fluorene derivative alternated with thiophene units is presented: poly(9,9'-dioctylfluorene-thiophene) (LAPPS29). Photophysical studies demonstrated that in the solid state only preformed ground state aggregates are responsible for exciton formation. These aggregates are formed with a wide range of size distribution. The emission from isolated segments is quenched either by resonant energy transfer, or by migration processes. Also, the main photovoltaic parameters are discussed in connection with the photophysical behavior.

Decomposing Blaschke Products And Polynomials

The goal of this paper is to contribute to the understanding of complex polynomials and Blaschke products, two very important function classes in mathematics. For a polynomial, $f,$ of degree $n,$ we study when it is possible to write $f$ as a composition $f=g\circ h$, where $g$ and $h$ are polynomials, each of degree less than $n.$ A polynomial is defined to be \emph{decomposable }if such an $h$ and $g$ exist, and a polynomial is said to be \emph{indecomposable} if no such $h$ and $g$ exist. We apply the results of Rickards in \cite{key-2}. We show that $$C_{n}=\{(z_{1},z_{2},...,z_{n})\in\mathbb{C}^{n}\,|\,(z-z_{1})(z-z_{2})...(z-z_{n})\,\mbox{is decomposable}\},$$ has measure $0$ when considered a subset of $\mathbb{R}^{2n}.$ Using this we prove the stronger result that $$D_{n}=\{(z_{1},z_{2},...,z_{n})\in\mathbb{C}^{n}\,|\,\mbox{There exists\,}a\in\mathbb{C}\,\,\mbox{with}\,\,(z-z_{1})(z-z_{2})...(z-z_{n})(z-a)\,\mbox{decomposable}\},$$ also has measure zero when considered a subset of $\mathbb{R}^{2n}.$ We show that for any polynomial $p$, there exists an $a\in\mathbb{C}$ such that $p(z)(z-a)$ is indecomposable, and we also examine the case of $D_{5}$ in detail. The main work of this paper studies finite Blaschke products, analytic functions on $\overline{\mathbb{D}}$ that map $\partial\mathbb{D}$ to $\partial\mathbb{D}.$ In analogy with polynomials, we discuss when a degree $n$ Blaschke product, $B,$ can be written as a composition $C\circ D$, where $C$ and $D$ are finite Blaschke products, each of degree less than $n.$ Decomposable and indecomposable are defined analogously. Our main results are divided into two sections. First, we equate a condition on the zeros of the Blaschke product with the existence of a decomposition where the right-hand factor, $D,$ has degree $2.$ We also equate decomposability of a Blaschke product, $B,$ with the existence of a Poncelet curve, whose foci are a subset of the zeros of $B,$ such that the Poncelet curve satisfies certain tangency conditions. This result is hard to apply in general, but has a very nice geometric interpretation when we desire a composition where the right-hand factor is degree 2 or 3. Our second section of finite Blaschke product results builds off of the work of Cowen in \cite{key-3}. For a finite Blaschke product $B,$ Cowen defines the so-called monodromy group, $G_{B},$ of the finite Blaschke product. He then equates the decomposability of a finite Blaschke product, $B,$ with the existence of a nontrivial partition, $\mathcal{P},$ of the branches of $B^{-1}(z),$ such that $G_{B}$ respects $\mathcal{P}$. We present an in-depth analysis of how to calculate $G_{B}$, extending Cowen's description. These methods allow us to equate the existence of a decomposition where the left-hand factor has degree 2, with a simple condition on the critical points of the Blaschke product. In addition we are able to put a condition of the structure of $G_{B}$ for any decomposable Blaschke product satisfying certain normalization conditions. The final section of this paper discusses how one can put the results of the paper into practice to determine, if a particular Blaschke product is decomposable. We compare three major algorithms. The first is a brute force technique where one searches through the zero set of $B$ for subsets which could be the zero set of $D$, exhaustively searching for a successful decomposition $B(z)=C(D(z)).$ The second algorithm involves simply examining the cardinality of the image, under $B,$ of the set of critical points of $B.$ For a degree $n$ Blaschke product, $B,$ if this cardinality is greater than $\frac{n}{2}$, the Blaschke product is indecomposable. The final algorithm attempts to apply the geometric interpretation of decomposability given by our theorem concerning the existence of a particular Poncelet curve. The final two algorithms can be implemented easily with the use of an HTML

sqv-3, -7, and -8, a set of genes affecting morphogenesis in Caenorhabditis elegans, encode enzymes required for glycosaminoglycan biosynthesis

sqv (squashed vulva) genes comprise a set of eight independent loci in Caenorhabditis elegans required zygotically for the invagination of vulval epithelial cells and maternally for normal oocyte formation and embryogenesis. Sequencing of sqv-3, sqv-7, and sqv-8 suggested a role for the encoded proteins in glycolipid or glycoprotein biosynthesis. Using a combination of in vitro analysis of SQV enzymatic activities, sqv+-mediated rescue of vertebrate cell lines, and biochemical characterization of sqv mutants, we show that sqv-3, -7, and -8 all affect the biosynthesis of glycosaminoglycans and therefore compromise the function of one specific class of glycoconjugates, proteoglycans. These findings establish the importance of proteoglycans and their associated glycosaminoglycans in epithelial morphogenesis and patterning during C. elegans development.

Linking osteopetrosis and pycnodysostosis: Regulation of cathepsin K expression by the microphthalmia transcription factor family

Various genetic conditions produce dysfunctional osteoclasts resulting in osteopetrosis or osteosclerosis. These include human pycnodysostosis, an autosomal recessive syndrome caused by cathepsin K mutation, cathepsin K-deficient mice, and mitf mutant rodent strains. Cathepsin K is a highly expressed cysteine protease in osteoclasts that plays an essential role in the degradation of protein components of bone matrix. Cathepsin K also is expressed in a significant fraction of human breast cancers where it could contribute to tumor invasiveness. Mitf is a member of a helix–loop–helix transcription factor subfamily, which contains the potential dimerization partners TFE3, TFEB, and TFEC. In mice, dominant negative, but not recessive, mutations of mitf, produce osteopetrosis, suggesting a functional requirement for other family members. Mitf also has been found—and TFE3 has been suggested—to modulate age-dependent changes in osteoclast function. This study identifies cathepsin K as a transcriptional target of Mitf and TFE3 via three consensus elements in the cathepsin K promoter. Additionally, cathepsin K mRNA and protein were found to be deficient in mitf mutant osteoclasts, and overexpression of wild-type Mitf dramatically up-regulated expression of endogenous cathepsin K in cultured human osteoclasts. Cathepsin K promoter activity was disrupted by dominant negative, but not recessive, mouse alleles of mitf in a pattern that closely matches their osteopetrotic phenotypes. This relationship between cathepsin K and the Mitf family helps explain the phenotypic overlap of their corresponding deficiencies in pycnodysostosis and osteopetrosis and identifies likely regulators of cathepsin K expression in bone homeostasis and human malignancy.

Mutations in the small subunit of the Drosophila U2AF splicing factor cause lethality and developmental defects.

The essential eukaryotic pre-mRNA splicing factor U2AF (U2 small nuclear ribonucleoprotein auxiliary factor) is required to specify the 3' splice at an early step in spliceosome assembly. U2AF binds site-specifically to the intron polypyrimidine tract and recruits U2 small nuclear ribonucleoprotein to the branch site. Human U2AF (hU2AF) is a heterodimer composed of a large (hU2AF65) and small (hU2AF35) subunit. Although these proteins associate in a tight complex, the biochemical requirement for U2AF activity can be satisfied solely by the large subunit. The requirement for the small subunit in splicing has remained enigmatic. No biochemical activity has been found for hU2AF35 and it has been implicated in splicing only indirectly by its interaction with known splicing factors. In the absence of a biochemical assay, we have taken a genetic approach to investigate the function of the small subunit in the fruit fly Drosophila melanogaster. A cDNA clone encoding the small subunit of Drosophila U2AF (dU2AF38) has been isolated and sequenced. The dU2AF38 protein is highly homologous to hU2AF35 containing a conserved central arginine- and serine-rich (RS) domain. A recessive P-element insertion mutation affecting dU2AF38 causes a reduction in viability and fertility and morphological bristle defects. Consistent with a general role in splicing, a null allele of dU2AF38 is fully penetrant recessive lethal, like null alleles of the Drosophila U2AF large subunit.

Survival of mouse pancreatic islet allografts in recipients treated with allogeneic small lymphocytes and antibody to CD40 ligand.

Combined treatment with allogeneic small lymphocytes or T-depleted small lymphocytes plus a blocking antibody to CD40 ligand (CD40L) permitted indefinite pancreatic islet allograft survival in 37 of 40 recipients that differed from islet donors at major and minor histocompatibility loci. The effect of the allogeneic small lymphocytes was donor antigen-specific. Neither treatment alone was as effective as combined treatment, although anti-CD40L by itself allowed indefinite islet allograft survival in 40% of recipients. Our interpretation is that small lymphocytes expressing donor antigens in the absence of appropriate costimulatory signals are tolerogenic for alloreactive host cells. Anti-CD40L antibody may prevent host T cells from inducing costimulatory signals in donor lymphocytes or islet grafts.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

A chronicle of the kings of England. From the time of the Romans government, unto the death of King James. Containing all passages of state and church, with all other observations proper for a chronicle ... Whereunto is added, the reign of King Charles the first, and the first thirteen years of his sacred majesty, King Charles the second ... All which additions are revised in this eighth impression, and freed from many errors and mistakes of the former editions.

The histories of Charles the first and Charles the second are by Edward Phillips; the account of the restoration is by Sir Thomas Clarges--Dict. of Nat. Biog.

Analyse des procès-verbaux des séances du 22 décembre 1800 au 20 novembre, 1874 / Publiée en exaecution de la délibération du 27 avril 1877.

t.1. 1800-1840 -- t.2. 1841-1870 -- t.3. 1871-1874 et Table des matières A-C -- T.4. Table des matières D à Z.

The Illinois program for comprehensive solar energy legislation /

Includes bibliographical references.

The potential economic impact of solar heated residential structures in Illinois, 1976-2000 /

Caption title.