Resting sites, edge effects and dispersion of a polyphagous Bactrocera fruit fly within crops of different architecture

The spot or strip application of poisoned protein bait is a lure-and-kill technique used for the management of fruit flies. Knowledge of where flies occur in the crop environment is an important part of maximizing the efficacy of this tool. Bactrocera tryoni is a polyphagous pest of horticulture for which very little is known about its distribution within crops. With particular reference to edge effects, we monitored the abundance of B. tryoni in two crops of different architecture; strawberry and apple. In strawberries, we found more flies on the crop edge early in the fruiting season, which lessened gradually and eventually disappeared as the season progressed. In apple orchards, no such edge effect was observed and flies were found equally throughout the orchard. We postulated these differences may be due to differences in crop height (high vs. short) and/or crop canopy architecture (opened and branched in apple, dense and closed in strawberry). In a field cage trial, we tested these predictions using artificial plants of different height and canopy condition. Height and canopy structure type had no significant effects on fly oviposition and protein feeding, but the 'apple' type canopy significantly influenced resting. We thus postulate that there was an edge effect in strawberry because the crop was not providing resting sites and flies were doing so in vegetation around the field margins. The finding that B. tryoni shows different resting site preferences based on plant architecture offers the potential for strategic manipulation of the fly through specific border or inter-row plantings. © 2013 Blackwell Verlag GmbH.

Continuous combined microwave and hot air treatment of apples for fruit fly (Bactrocera tryoni and B. jarvisi) disinfestation

Apples at 24 ± 2 °C were heated in a pilot scale hot air assisted (40 °C) continuous pentagonal microwave system, to evaluate the effectiveness of this treatment on insect mortality (variety Mutsu) and fruit quality (variety Granny Smith). An average temperature of 53.4 ± 1.3 °C at core, bottom and flesh of the apple was recorded at the end of the treatment. One hundred percent mortality of the most tolerant stage of Queensland fruit fly (Bactrocera tryoni, Froggatt) and Jarvis's fruit fly (Bactrocera jarvisi, Tryon), were observed when the Mortality value (M52, equivalent time of isothermal treatment at 52 °C) at the slowest heating point applicable for each experiment was ≥ 50 min and ≥ 37 min, respectively. Results showed that microwave heat treatment is effective for insect disinfestation without any adverse impact on total soluble solids, flesh or peel firmness of the treated apples. The treated apples recorded a significantly higher pH and lower ion leakage than the untreated apples after 3 or 4 weeks. Therefore, the microwave heat treatment has the potential to be developed as an alternative chemical free quarantine treatment against economically significant insect pests. Industrial relevance Hot air assisted microwave heating of fruits and vegetables, is more cost effective compared to vapour heat treatment and ionising radiation for disinfestation of insects. Microwave treatment is environmentally friendly compared to fumigation and chemical treatments. Hot air assisted microwave disinfestation can be performed at farms or centralised pack houses since the capital cost would be comparatively lower than vapour heat or ionising radiation treatments.

Bactrocera frauenfeldi (Diptera: Tephritidae), an invasive fruit fly in Australia that may have reached the extent of its spread due to environmental variables

Bactrocera frauenfeldi (Schiner), the ‘mango fruit fly’, is a horticultural pest originating from the Papua New Guinea region. It was first detected in Australia on Cape York Peninsula in north Queensland in 1974 and had spread to Cairns by 1994 and Townsville by 1997. Bactrocera frauenfeldi has not been recorded further south since then despite its invasive potential, an absence of any controls and an abundance of hosts in southern areas. Analysis of cue-lure trapping data from 1997 to 2012 in relation to environmental variables shows that the distribution of B. frauenfeldi in Queensland correlates to locations with a minimum temperature for the coldest month >13.2°C, annual temperature range <19.3°C, mean temperature of the driest quarter >20.2°C, precipitation of the wettest month >268 mm, precipitation of the wettest quarter >697 mm, temperature seasonality <30.9°C (i.e. lower temperature variability) and areas with higher human population per square kilometre. Annual temperature range was the most important variable in predicting this species' distribution. Predictive distribution maps based on an uncorrelated subset of these variables reasonably reflected the current distribution of this species in northern Australia and predicted other areas in the world potentially at risk from invasion by this species. This analysis shows that the distribution of B. frauenfeldi in Australia is correlated to certain environmental variables that have most likely limited this species' spread southward in Queensland. This is of importance to Australian horticulture in demonstrating that B. frauenfeldi is unlikely to establish in horticultural production areas further south than Townsville.

Evaluation of a systems approach to control Queensland fruit fly (Bactrocera tryoni)in stonefruit as an alternative to fenthion

Queensland fruit fly (Bactrocera tryoni) is a significant quarantine pest of stonefruit. To access domestic markets within Australia stonefruit require treatment to ensure they are free of fruit flies. Due to the recent restriction of the organophosphate pesticides, fenthion and dimethoate, the stonefruit industry now faces a significant challenge to control fruit flies. In this field trial we quantified the level of control achieved by a 'best case' systems approach that relied on currently available and registered control measures. This system included protein bait sprays, Male Annihilation Technique, insecticide cover sprays of trichlorfon, maldison and spinetoram and inspection and culling of damaged fruit. We found that in two out of the three trial orchards, packed fruit samples from Gatton (QLD) and Bangalow (NSW) had low levels of fruit fly infestation; 1.47 and 2.97% respectively. However, at the third property located at Alstonville (NSW) a high level of infestation (51.63%) was found in packed nectarines, which was likely attributed to the late implementation of the systems approach. This trial has demonstrated the potential for fruit fly control without relying on fenthion, however further modification of the system is needed to refine and increase efficacy.

The mating system of the true fruit fly Bactrocera tryoniand its sister-species,Bactrocera neohumeralis

The frugivorous ‘true’ fruit fly, Bactrocera tryoni (Queensland fruit fly), is presumed to have a non-resourced-based lek mating system. This is largely untested, and contrary data exists to suggest Bactrocera tryoni may have a resource-based mating system focused on fruiting host plants. We tested the mating system of Bactrocera tryoni, and its close sibling Bactrocera neohumeralis, in large field cages using laboratory reared flies. We used observational experiments that allowed us to determine if: (i) mating pairs were aggregated or non-aggregated; (ii) mating system was resource or non-resource based; (iii) flies utilised possible landmarks (tall trees over short) as mate-rendezvous sites; and (iv) males called females from male-dominated leks. We recorded nearly 250 Bactrocera tryoni mating pairs across all experiments, revealing that: (i) mating pairs were aggregated; (ii) mating nearly always occurred in tall trees over short; (iii) mating was non-resource based; and (iv) that males and females arrived at the mate-rendezvous site together with no evidence that males preceded females. Bactrocera neohumeralis copulations were much more infrequent (only 30 mating pairs in total), but for those pairs there was a similar preference for tall trees and no evidence of a resource-based mating system. Some aspects of Bactrocera tryoni mating behaviour align with theoretical expectations of a lekking system, but others do not. Until evidence for unequivocal female choice can be provided (as predicted under a true lek), the mating system of Bactrocera tryoni is best described as a non-resource based, aggregation system for which we also have evidence that land-marking may be involved. This article is protected by copyright. All rights reserved

Low-dose methyl bromide fumigation as a quarantine disinfestation treatment for nectarines against Queensland fruit fly (Diptera:Tephritidae)

White nectarines (Prunus persica var. nucipersica) were fumigated with methyl bromide (MB) at a nominal treatment dose of 18 g m-3 at 18°C for 5 h and 30 min as a quarantine disinfestation treatment against Bactrocera tryoni, the Queensland fruit fly. Three large scale trials were conducted against each of the four immature lifestages, eggs and first, second and third instars. There were no survivors from the estimated 43,614 eggs, 41,873 first instars, 41,345 second instars and 33,549 third instars treated, thereby resulting in an efficacy of GROTERDAN99.99% mortality at the 95% confidence level for each lifestage. Of the 12 trials reported herein, the highest concentration of MB, sampled from the chamber headspace analysed by gas chromatography, was 18.7 g m-3. The maximum chamber temperature from 5 min readings was 19.7°C and the maximum fruit core temperature was 19.5°C. The treatment time for all trials was exactly 5.5 h. Thus the recommended treatment dose to disinfest nectarines from B. tryoni is 19.0 g m-3 MB at 20.0°C for 5.5 h. Fruit quality trials were conducted on white nectarines at three combinations of treatment parameters: 15 g m-3 MB at 19°C for 5.25 h; 18 g m-3 MB at 19°C for 5.5 h and 21 g m-3 MB at 19°C for 5.5 h. The fruit were stored at 0, 4 and 8 days at 4°C and 8 days at 4°C followed by 4 d at 22°C. They were then were assessed for skin colour, flesh colour, skin defects, flesh defects, fruit weight loss, flesh firmness, total soluble solids, titratable acidity and rots. There was no significant difference between untreated control and MB treated fruits in any of the parameters measured. Thus the treatments did not have adverse effects on fruit quality.

Evaluation of tomato production systems at Bowen in mitigating the risk of fruit fly infestation: a systems approach for market access

Queensland fruit flies Bactrocera tryoni and B. neohumeralis are considered major quarantine pests of tomato, a major crop in the horticultural production district around Bowen, North Queensland, Australia. Preharvest and/or postharvest treatments are required to meet the market access requirements of both domestic and international trading partners. The suspension from use of dimethoate and fenthion, the two insecticides used for fruit fly control, has resulted in the loss of both pre and postharvest uses in fresh tomato. Research undertaken quantitatively at Bowen evaluated the effectiveness of pre-harvest production systems without specific fruit fly controls and postharvest mitigation measures in reducing the risk of fruit fly infestation in tomato. A district-wide trapping using cue-lure baited traps was undertaken to determine fruit fly seasonal patterns in relation to the cropping seasons. A total of 17,626 field-harvested and 11,755 pack-house tomatoes were sampled from ten farms over three cropping seasons (2006-2009). The fruit were incubated and examined for fruit fly infestation. No fruit fly infested fruit were recorded over the three seasons in either the field or the pack-house samples. Statistical analyses showed that upper infestation levels were extremely low (between 0.025 and 0.062%) at the 95% confidence level. The trap catches showed a seasonal pattern in fruit fly activity, with low numbers during the autumn and winter months, rising slightly in spring and peaking in summer. This seasonal pattern was similar over the four seasons. The main two species of fruit fly caught were B. tryoni and B. neohumeralis. Based on the results, it is clear that the risk of fruit fly infestation is extremely low under the current production systems in the Bowen region.

Natural variation and Biogeography of the melon fruit fly, Zeugodacus cucurbitae (Diptera : Tephritidae), in Southeast-Asia and the west-pacific

This thesis used multidisciplinary approaches which greatly enhance our understanding of population structure and can be particularly powerful tools for resolving variation of melon fly over geographic and temporal scales, and for determining invasive pathways. The results from this thesis reinforce the value of integrating multiple data sets to better understand and resolve natural variation within an important pest to determine whether there are cryptic species, discrete lineages or host races, and to identify dispersal pathways in an invasive pest. These results are instructive for regional biosecurity, trade and quarantine, and provide important background for future area-wide management programmes. The integrative methodology adopted in this thesis is applicable to a variety of other insect pests.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Light- and cytokinin-induced changes in the levels of leucine and tyrosine isoaccepting tRNA species and modified nucleotide contents of total tRNA in cucumber seedlings

We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.

Absence of parallelism between polyamine and nucleic acid contents during induced growth of cucumber cotyledons

The cytokinins (benzyladenine or benzyladenosine) decreased spermidine and spermine contents despite increasing putrescine content, when administered to isolated cotyledons of Cucumis sativus L. var. Guntur in organ culture. KCl decreased putrescine contents, although marginally increasing polyamine contents. The cytokinins and/or KCl augmented nucleic acid biosynthesis and accumulation, resulting in enhanced growth and differentiation of the isolated cotyledons. These observations show that polyamine accumulation and growth are not always coupled.

Cucumber chloroplast trnL(CAA) gene: nucleotide sequence and in vivo expression analysis in etiolated cucumber seedlings treated with benzyladenine and light.

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Cucumber chloroplast trnL(CAA) gene: nucleotide sequence and in vivo expression analysis in etiolated cucumber seedlings treated with benzyladenine and light

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Identification and characterization of thionucleosides in the total tRNA of cucumber cotyledons

Total tRNA isolated from cucumber cotyledons grown in the presence of radioactive sulfur was analyzed for the occurrence of thionucleosides. The analysis revealed the presence of at least five thionucleosides which were identified as 5-methylaminomethyl-2-thiouridine (mnm5s2U), 2-methylthio-N6-isopentenyladenosine (ms2i6A), 2-methylthio-N6-hydroxyisopentenyladenosine (ms2io6A), 5-methyl-2-thiouridine (m5s2U) and N-[(9-beta-ribofuranosyl-2- methylthiopurine-2-yl)-carbamoyl]-threonine (ms2t6A). A comparison of relative amounts of these thionucleosides in the total tRNAs of dark-, and light-grown cotyledons shows that the relative amounts of ms2i6A, ms2io6A and ms2t6A remain unchanged whereas mnm5s2U increases with a concomitant decrease in the relative amounts of m5s2U after light treatment of dark-grown cotyledons.