996 resultados para Cis-acting Elements
Resumo:
Aromatase plays a key role in sex differentiation of gonads. In this study, we cloned the full-length cDNA of ovarian aromatase from protogynous hermaphrodite red-spotted grouper (Epinephelus akaara), and prepared the corresponding anti-EaCyp19a1a antiserum. Western blot and immunofluorescence studies revealed ovary-specific expression pattern of EaCyp19a1a in adults and its dynamic expression change during artificial sex reversal. EaCyp19a1a was expressed by follicular cells of follicular layer around oocytes because strong EaCyp19a1a immunofluorescence was observed in the cells of ovaries. During artificial sex reversal, EaCyp19a1a expression dropped significantly from female to male, and almost no any positive EaCyp19a1a signal was observed in testicular tissues. Then, we cloned and sequenced a total of 1967 bp T-flanking sequence of EaCyp19a1a promoter, and showed a number of potential binding sites for some transcriptional factors, such as SOX5, GATA gene family, CREB, AP1, FOXL1, C/EBP, ARE and SF-1. Moreover, we prepared a series of 5' deletion promoter constructs and performed in vitro luciferase assays of EaCyp19a1a promoter activities. The data indicated that the CREB regulation region from -1010 to -898 might be a major cis-acting element to EaCyp19a1a promoter, whereas the elements GATA and SOX5 in the region from -1216 to -1010 might be suppression elements. Significantly, we found a common conserved sequence region in the fish ovary-type aromatase promoters with identities from 93% to 34%. And, the motifs of TATA box, SF-1, SOX5, and CREB existed in the region and were conserved among the most of fish species. (C) 2009 Elsevier Ireland Ltd. All rights reserved.
Resumo:
The nuclear respiratory factor-1 (NRF1) gene is activated by lipopolysaccharide (LPS), which might reflect TLR4-mediated mitigation of cellular inflammatory damage via initiation of mitochondrial biogenesis. To test this hypothesis, we examined NRF1 promoter regulation by NFκB, and identified interspecies-conserved κB-responsive promoter and intronic elements in the NRF1 locus. In mice, activation of Nrf1 and its downstream target, Tfam, by Escherichia coli was contingent on NFκB, and in LPS-treated hepatocytes, NFκB served as an NRF1 enhancer element in conjunction with NFκB promoter binding. Unexpectedly, optimal NRF1 promoter activity after LPS also required binding by the energy-state-dependent transcription factor CREB. EMSA and ChIP assays confirmed p65 and CREB binding to the NRF1 promoter and p65 binding to intron 1. Functionality for both transcription factors was validated by gene-knockdown studies. LPS regulation of NRF1 led to mtDNA-encoded gene expression and expansion of mtDNA copy number. In cells expressing plasmid constructs containing the NRF-1 promoter and GFP, LPS-dependent reporter activity was abolished by cis-acting κB-element mutations, and nuclear accumulation of NFκB and CREB demonstrated dependence on mitochondrial H(2)O(2). These findings indicate that TLR4-dependent NFκB and CREB activation co-regulate the NRF1 promoter with NFκB intronic enhancement and redox-regulated nuclear translocation, leading to downstream target-gene expression, and identify NRF-1 as an early-phase component of the host antibacterial defenses.
Resumo:
Ein essentieller Bestandteil in dem Mechanismus der Translationskontrolle sind RNA-Protein-Wechselwirkungen. Solche Interaktionen konnten in Translationssystemen an zwei unabhängigen cis-regulierenden Elementen durch in vitro-Bindungsanalysen mit individuellen rekombinanten Proteinen dokumentiert werden. Im Fall des translational control elements (TCE), welches ein konserviertes Sequenz-Element in der Mst(3)CGP-Genfamilie darstellt, wird eine negative Translationskontrolle durch die Bindung der Proteine CG3213, CG12470, CG1898, dFMR1, Exuperantia und Orb2 an diese Sequenz vermittelt (Stinski, 2011). Neben den in Bindungsstudien positiv getesteten Kandidaten dFMR1 und Orb2 (Stinski, 2011) wurde in der vorliegenden Dissertation CG3213 als weiterer direkter Bindungspartner an das TCE dokumentiert. Ein Abgleich der genomweiten Zusammenstellung von Proteininteraktionen in der Datenbank InterologFinder lieferte zwei weitere potentielle Kandidaten: CG34404 und CG3727. Allerdings schließen Northern-Analysen und das Proteinexpressionsmuster eine zentrale Rolle in der Drosophila-Spermatogenese für diese nahezu aus. In Kolokalisationsstudien einiger TCE-Komplex-Kandidaten mit CG3213 als Referenz konnten eindeutige Übereinstimmungen der Fluoreszenzmuster mit CG12470 in der postmeiotischen Phase beschrieben werden, wohingegen mit Orb2 (postmeiotisch) und CG1898 (prämeiotisch) nur eine geringe Kolokalisation erkannt wurde. Punktstrukturen in den Verteilungsmustern sowohl von CG3213 als auch von CG12470 ließen sich nicht mit ER- und mitochondrienspezifischen Markern korrelieren. Im Anschluss der Meiose konnte eine deutliche Intensitätserhöhung des CG3213-Proteins beobachtet werden, was eventuell durch eine veränderte Translationseffizienz zustande kommen könnte. Exuperantia (Exu) stellt einen bekannten Regulator für eine Reihe von translationskontrollierten mRNAs dar (Wang und Hazelrigg, 1994). Die Quantifizierungen der CG3213-mRNA in exu-mutantem Hintergrund bestätigen, dass auch die Transkriptmenge der CG3213-mRNA durch Exu reguliert wird, was die obige Interpretation stützen würde. Für das zweite cis-regulierende Element, das cytoplasmic polyadenylation element (CPE), konnte eine direkte Bindung mit dem CPEB-Homolog in Drosophila (Orb2) gezeigt werden, welches auch eine Komponente des mst87F-RNP-Komplexes ist. Ein vermuteter Interaktionspartner dieses CPEBs ist Tob, weshalb die Verteilung beider Proteine in einem Kombinationsstamm verglichen wurde. In dem teilweise übereinstimmenden Fluoreszenzmuster ist Tob an den distalen Spermatidenenden auffallend konzentriert. Das gesamte Tob-Muster jedoch legt eine Verteilung in den Mitochondrien nahe, wie die MitoTracker®-Färbung belegt. Somit wurde erstmals ein Mitglied der Tob/BTG-Genfamilie in der Drosophila-Spermatogenese mit Mitochondrien in Verbindung gebracht. Die Lokalisierung dieser Proteine ist bislang unklar, jedoch konnte eine Kernlokalisation trotz der N-terminalen NLS-Sequenz mit Hilfe einer Kernfärbung ausgeschlossen werden.
Resumo:
Glycogen synthase, an enzyme involved in glycogen biosynthesis, is regulated by phosphorylation and by the allosteric ligand glucose-6-phosphate (G6P). In addition, enzyme levels can be regulated by changes in gene expression. We recently cloned a cDNA for glycogen synthase (gsn) from Neurospora crassa, and showed that gsn transcription decreased when cells were exposed to heat shock (shifted from 30degreesC to 45degreesC). In order to understand the mechanisms that control gsn expression, we isolated the gene, including its 5' and 3' flanking regions, from the genome of N. crassa. An ORF of approximately 2.4 kb was identified, which is interrupted by four small introns (II-V). Intron I (482 bp) is located in the 5'UTR region. Three putative Transcription Initiation Sites (TISs) were mapped, one of which lies downstream of a canonical TATA-box sequence (5'-TGTATAAA-3'). Analysis of the 5'-flanking region revealed the presence of putative transcription factor-binding sites, including Heat Shock Elements (HSEs) and STress Responsive Elements (STREs). The possible involvement of these motifs in the negative regulation of gsn transcription was investigated using Electrophoretic Mobility Shift Assays (EMSA) with nuclear extracts of N. crassa mycelium obtained before and after heat shock, and DNA fragments encompassing HSE and STRE elements from the 5'-flanking region. While elements within the promoter region are involved in transcription under heat shock, elements in the 5'UTR intron may participate in transcription during vegetative growth. The results thus suggest that N. crassa possesses trans-acting elements that interact with the 5'-flanking region to regulate gsn transcription during heat shock and vegetative growth.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Bidirectional promoters regulate adjacent genes organized in a divergent fashion (head to head orientation). Several Reports pertaining to bidirectional promoters on a genomic scale exists in mammals. This work provides the essential background on theoretical and experimental work to carry out a genomic scale analysis of bidirectional promoters in plants. A computational study was performed to identify putative bidirectional promoters and the over-represented cis-regulatory motifs from three sequenced plant genomes: rice (Oryza sativa), Arabidopsis thaliana, and Populus trichocarpa using the Plant Cis-acting Regulatory DNA Elements (PLACE) and PLANT CARE databases. Over-represented motifs along with their possible function were described with the help of a few conserved representative putative bidirectional promoters from the three model plants. By doing so a foundation was laid for the experimental evaluation of bidirectional promoters in plants. A novel Agrobacterium tumefaciens mediated transient expression assay (AmTEA) was developed for young plants of different cereal species and the model dicot Arabidopsis thaliana. AmTEA was evaluated using five promoters (six constructs) and two reporter genes, gus and egfp. Efficacy and stability of AmTEA was compared with stable transgenics using the Arabidopsis DEAD-box RNA helicase family gene promoter. AmTEA was primarily developed to overcome the many problems associated with the development of transgenics and expression studies in plants. Finally a possible mechanism for the bidirectional activity of bidirectional promoters was highlighted. Deletion analysis using promoter-reporter gene constructs identified three rice promoters to be bidirectional. Regulatory elements located in the 5’- untranslated regions (UTR) of one of the genes of the divergent gene pair were found to be responsible for their bidirectional ctivity
Resumo:
Vitamin A and its metabolite retinoic acid (RA) are essential elements for normal lung development and the differentiation of lung epithelial cells. We previously showed that RA rapidly activated cyclic AMP response element-binding protein (CREB) in a nonclassical manner in normal human tracheobronchial epithelial (NHTBE) cells. In the present study, we further demonstrated that this nonclassical signaling of RA on the activation of CREB plays a critical role in regulating the expression of airway epithelial cell differentiation markers, the MUC2, MUC5AC, and MUC5B genes. We found that RA rapidly activates the protein kinase Calpha isozyme and transmits the activation signal to CREB via the Raf/MEK/extracellular signal-regulated kinase/p90 ribosomal S6 kinase (RSK) pathway. Activated RSK translocated from the cytoplasm to the nucleus, where it phosphorylates CREB. Activated CREB then binds to a cis-acting replication element motif on the promoter (at nucleotides [nt] -878 to -871) of the MUC5AC gene. The depletion of CREB using small interfering RNA abolished not only the RA-induced MUC5AC but also RA-induced MUC2 and MUC5B. Taken together, our findings demonstrate that CREB activation via this nonclassical RA signaling pathway may play an important role in regulating the expression of mucin genes and mediating the early biological effects of RA during normal mucous differentiation in NHTBE cells.
Resumo:
Expression of the differentiated skeletal muscle phenotype is a process that appears to occur in at least two stages. First, pluripotent stem cells become committed to the myogenic lineage. Although undifferentiated and capable of continued proliferation, determined myoblasts are restricted to a single developmental fate. Upon receiving the appropriate environmental signals, these determined myoblasts withdraw from the cell cycle, fuse to form multi-nucleated myotubes, and begin to express a battery of muscle-specific gene products that make up the functional and contractile apparatus of the muscle. This project is aimed at the identification and characterization of factors that control the determination and differentiation of myogenic cells. We have cloned a cDNA, called myogenin, that plays an important role in these processes. Myogenin is expressed exclusively in skeletal muscle in vivo and myogenic cell lines in vitro. Its expression is sharply upregulated during differentiation. When constitutively expressed in fibroblasts, myogenin converts these cells to the myogenic lineage. Transfected cells behave as myogenic tissue culture cells with respect to the genes they express, the way they respond to environmental cues, and are capable of fusing to form multinucleated myotubes. Sequence analysis showed that this cDNA has homology to a family of transcription factors in a region of 72 amino acids known as the basic helix-loop-helix motif. This domain appears to mediate binding to a DNA sequence element known as an E-box (CANNTG) essential for the activity of the enhancers of many muscle-specific genes.^ Analysis of myogenin in tissue culture cells showed that its expression is responsive to many of the environmental cues, such as the presence of growth factors and oncogenes, that modulate myogenesis. In an attempt to identify the cis- and trans-elements that control myogenin expression and thereby understand what factors are responsible for the establishment of the myogenic lineage, we have cloned the myogenin gene. After analysis of the gene structure, we constructed a series of reporter constructs from the 5$\prime$ upstream sequence of the myogenin gene to determine which cis-acting sequences might be important in myogenin regulation. We found that 184 nucleotides of the 5$\prime$ sequence was sufficient to direct high-level muscle-specific expression of the reporter gene. Two sequence elements present in the 184 fragment, an E-box and a MEF-2 site, have been shown previously to be important in muscle-specific transcription. Mutagenesis of these sites revealed that both sites are necessary for full activity of the myogenin promoter, and suggests that a complex hierarchy of transcription factors control myogenic differentiation. ^
Resumo:
PAX6, a member of the paired-type homeobox gene family, is expressed in a partially and temporally restricted pattern in the developing central nervous system, and its mutation is responsible for human aniridia (AN) and mouse small eye (Sey). The objective of this study was to characterize the PAX6 gene regulation at the transcriptional level, and thereby gain a better understanding of the molecular basis of the dynamic expression pattern and the diversified function of the human PAX6 gene.^ Initially, we examined the transcriptional regulation of the PAX6 gene by transient transfection assays and identified multiple cis-regulatory elements that function differently in different cell lines. The transcriptional initiation site was identified by RNase protection and primer extension assays. Examination of the genomic DNA sequence indicated that the PAX6 promoter has a TATA like-box (ATATTTT) at $-$26 bp, and two CCAAT-boxes are located at positions $-$70 and $-$100 bp. A 38 bp ply (CA) sequence was located 992 bp upstream from the initiation site. Transient transfection assays in glioblastoma cells and leukemia cells indicate that a 92 bp region was required for basal level PAX6 promoter activity. Gel retardation assays showed that this 92 bp sequence can form four DNA-protein complexes which can be specifically competed by a 31-mer oligonucleotide containing a PAX6 TATA-like sequence or an adenovirus TATA box. The activation of the promoter is positively correlated with the expression of PAX6 transcripts in cells tested.^ Based on the results obtained from the in vitro transfection assays, we did further dissection assay and functional analysis in both cell-culture and transgenic mice. We found that a 5 kb upstream promoter sequence is required for the tissue specific expression in the forebrain region which is consistent with that of the endogenous PAX6 gene. A 267 bp cell-type specific repressor located within the 5 kb fragment was identified and shown to direct forebrain specific expression. The cell-type specific repressor element has been narrowed to a 30 bp region which contains a consensus E-box by in vitro transfection assays. The third regulatory element identified was contained in a 162 bp sequence (+167 to +328) which functions as a midbrain repressor, and it appeared to be required for establishing the normal expression pattern of the PAX6 gene. Finally, a highly conserved 216 bp sequence identified in intron 4 exhibited as a spinal cord specific enhancer. And this 216 bp cis-regulatory element can be used as a marker to trace the differentiation and migration of progenitor cells in the developing spinal cord. These studies show that the concerted action of multiple cis-acting regulatory elements located upstream and downstream of the transcription initiation site determines the tissue specific expression of PAX6 gene. ^
Resumo:
Three U7 RNA-related sequences were isolated from mouse genomic DNA libraries. Only one of the sequences completely matches the published mouse U7 RNA sequence, whereas the other two apparently represent pseudogenes. The matching sequence represents a functional gene, as it is expressed after microinjection into Xenopus laevis oocytes. Sequence variations of the conserved cis-acting 5' and 3' elements of U RNA genes may partly explain the low abundance of U7 RNA.
Resumo:
Myxococcus xanthus is a Gram-negative soil bacterium that undergoes multicellular development when high-density cells are starved on a solid surface. Expression of the 4445 gene, predicted to encode a periplasmic protein, commences 1.5 h after the initiation of development and requires starvation and high density conditions. Addition of crude or boiled supernatant from starving high-density cells restored 4445 expression to starving low-density cells. Addition of L-threonine or L-isoleucine to starving low-density cells also restored 4445 expression, indicating that the high-density signaling activity present in the supernatant might be composed of extracellular amino acids or small peptides. To investigate the circuitry integrating these starvation and high-density signals, the cis- and trans-acting elements controlling 4445 expression were identified. The 4445 transcription start site was determined by primer extension analysis to be 58 by upstream of the predicted translation start site. The promoter region contained a consensus sequence characteristic of e&barbelow;xtrac&barbelow;ytoplasmic f&barbelow;unction (ECF) sigma factor-dependent promoters, suggesting that 4445 expression might be regulated by an ECF sigma factor-dependent pathway, which are known to respond to envelope stresses. The small size of the minimum regulatory region, identified by 5′-end deletion analysis as being only 66 by upstream of the transcription start site, suggests that RNA polymerase could be the sole direct regulator of 4445 expression. To identify trans-acting negative regulators of 4445 expression, a strain containing a 4445-lacZ was mutagenized using the Himar1-tet transposon. The four transposon insertions characterized mapped to an operon encoding a putative ECF sigma factor, ecfA; an anti-sigma factor, reaA; and a negative regulator, reaB. The reaA and the reaB mutants expressed 4445 during growth and development at levels almost 100-fold higher than wild type, indicating that these genes encode negative regulators. The ecfA mutant expressed 4445-lacZ at basal levels, indicating that ecfA is a positive regulator. High Mg2+ concentrations over-stimulated this ecfA pathway possibly due to the depletion of exopolysaccharides and assembled type IV pili. These data indicate that the ecfA operon encodes a new regulatory stress pathway that integrates and transduces starvation and cell density cues during early development and is also responsive to cell-surface alterations.^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
The intracellular distribution of RNAs depends on interactions of cis-acting nuclear export elements or nuclear retention elements with trans-acting nuclear transport or retention factors. To learn about the relationship between export and retention, we isolated RNAs that are exported from nuclei of Xenopus laevis oocytes even when most RNA export is blocked by an inhibitor of Ran-dependent nucleocytoplasmic transport, the Matrix protein of vesicular stomatitis virus. Export of the selected RNAs is saturable and specific. When present in chimeric RNAs, the selected sequences acted like nuclear export elements in promoting efficient export of RNAs that otherwise are not exported; the pathway used for export of these chimeric RNAs is that used for the selected RNAs alone. However, these chimeric RNAs, unlike the selected RNAs, were not exported in the presence of Matrix protein; thus, the nonselected sequences can cause retention of the selected RNA sequences under conditions of impaired nucleocytoplasmic transport. We propose that most RNAs are transiently immobilized in the nucleus and that release of these RNAs is an essential and early step in export. Release correlates with functional Ran-dependent transport, and the lack of export of chimeric RNAs may result from interference with the Ran system.
Resumo:
Autonomously replicating sequence (ARS) elements, which function as the cis-acting chromosomal replicators in the yeast Saccharomyces cerevisiae, depend upon an essential copy of the 11-bp ARS consensus sequence (ACS) for activity. Analysis of the chromosome III replicator ARS309 unexpectedly revealed that its essential ACS differs from the canonical ACS at two positions. One of the changes observed in ARS309 inactivates other ARS elements. This atypical ACS binds the origin recognition complex efficiently and is required for chromosomal replication origin activity. Comparison of the essential ACS of ARS309 with the essential regions of other ARS elements revealed an expanded 17-bp conserved sequence that efficiently predicts the essential core of ARS elements.
Resumo:
Nuclear matrix binding assays (NMBAs) define certain DNA sequences as matrix attachment regions (MARs), which often have cis-acting epigenetic regulatory functions. We used NMBAs to analyze the functionally important 15q11-q13 imprinting center (IC). We find that the IC is composed of an unusually high density of MARs, located in close proximity to the germ line elements that are proposed to direct imprint switching in this region. Moreover, we find that the organization of MARs is the same at the homologous mouse locus, despite extensive divergence of DNA sequence. MARs of this size are not usually associated with genes but rather with heterochromatin-forming areas of the genome. In contrast, the 15q11-q13 region contains multiple transcribed genes and is unusual for being subject to genomic imprinting, causing the maternal chromosome to be more transcriptionally silent, methylated, and late replicating than the paternal chromosome. We suggest that the extensive MAR sequences at the IC are organized as heterochromatin during oogenesis, an organization disrupted during spermatogenesis. Consistent with this model, multicolor fluorescence in situ hybridization to halo nuclei demonstrates a strong matrix association of the maternal IC, whereas the paternal IC is more decondensed, extending into the nuclear halo. This model also provides a mechanism for spreading of the imprinting signal, because heterochromatin at the IC on the maternal chromosome may exert a suppressive position effect in cis. We propose that the germ line elements at the 15q11-q13 IC mediate their effects through the candidate heterochromatin-forming DNA identified in this study.