978 resultados para CHROMOSOMAL TRANSLOCATION
Resumo:
Uranium is a natural radioactive metallic element; its effect on the organism is cumulative, and chronic exposure to this element can induce carcinogenesis. Three cities of the Amazon region-Monte Alegre, Prainha, and Alenquer-in North Brazil, are located in one of the largest uranium mineralization areas of the world. Radon is a radioactive gas, part of uranium decay series and readily diffuses through rock. In Monte Alegre, most of the houses are built of rocks removed from the Earth`s crust in the forest, where the uranium reserves lie. The objective of the present work is to determine the presence or absence of genotoxicity and risk of carcinogenesis induced by natural exposure to uranium and radon in the populations of these three cities. The frequency of micronuclei (MN) and chromosomal aberrations (CA) showed no statistically significant differences between the control population and the three study populations (P > 0.05). MN was also analyzed using the fluorescence in situ hybridization (FISH) technique, with a centromere-specific probe. No clastogenic and/or aneugenic effects were found in the populations. Using FISH analysis, other carcinogenesis biomarkers were analyzed, but neither the presence of the IGH/BCL2 translocation nor an amplification of the MYC gene and 22q21 region was detected. Clastogenicity and DNA damage were also not found in the populations analyzed using the alkaline comet assay. The mitotic index showed no cytotoxicity in the analyzed individuals` lymphocytes. Once we do not have data concerning radiation doses from other sources, such as cosmic rays, potassium, thorium, or anthropogenic sources, it is hard to determine if uranium emissions in this geographic region where our study population lives are too low to cause significant DNA damage. Regardless, genetic analyses suggest that the radiation in our study area is not high enough to induce DNA alterations or to interfere with mitotic apparatus formation. It is also possible that damages caused by radiation doses undergo cellular repair.
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
Insulin stimulates glucose uptake into muscle and fat cells by promoting the translocation of glucose transporter 4 (GLUT4) to the cell surface. Phosphatidylinositide 3-kinase (PI3K) has been implicated in this process. However, the involvement of protein kinase B (PKB)/Akt, a downstream target of PI3K in regulation of GLUT4 translocation, has been controversial. Here we report that microinjection of a PKB substrate peptide or an antibody to PKB inhibited insulin-stimulated GLUT4 translocation to the plasma membrane by 66 or 56%, respectively. We further examined the activation of PKB isoforms following treatment of cells with insulin or platelet-derived growth factor (PDGF) and found that PKB beta is preferentially expressed in both rat and 3T3-L1 adipocytes, whereas PKB alpha expression is down-regulated in 3T3-L1 adipocytes. A switch in growth factor response was also observed when 3T3-L1 fibroblasts were differentiated into adipocytes. While PDGF was more efficacious than insulin in stimulating PKB phosphorylation in fibroblasts, PDGF did not stimulate PKB beta phosphorylation to any significant extent in adipocytes, as assessed by several methods. Moreover, insulin, but not PDGF, stimulated the translocation of PKB beta to the plasma membrane and high-density microsome fractions of 3T3-L1 adipocytes. These results support a role for PKB beta in insulin-stimulated glucose transport in adipocytes.
Resumo:
We have previously isolated and characterized murine MYB binding protein (p160) 1a, a protein that specifically interacts with the leucine zipper motif within the negative regulatory domain of the c-Myb proto-oncoprotein, We now describe the molecular cloning of the human MYBBP1A cDNA and chromosomal localization to 17p13.3 by fluorescence in situ hybridization analysis, Given the likely presence of a tumor suppressor gene (or genes) within this region of chromosome 17, the position of MYBBP1A was further mapped by radiation hybrid analysis and was found to lie between markers D17S1828 and D17S938. A P1 artificial chromosome clone containing the 5' region of MYBBP1A was isolated and indicates a physical linkage between MYBBP1A and the 15-lipoxygenase gene (ALOX15), A novel, polymorphic (CA)(25) dinucleotide repeat was also isolated from this PAC and may serve as a useful marker for MYBBP1A and this region of chromosome 17. (C) 1999 Academic Press.
Resumo:
Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae) is one of the most chromosomally diverse of all animal genera. There is extensive karyotypic variation within many of the morphologically defined species, including A. munita (Schrader) which is here reported to have diploid chromosome counts ranging from 6 to more than 100. Each of the three morphologically defined subspecies of A. munita also displays considerable chromosomal variation: A. m. tereticornuta Gullan (2n =6, 8, 20, 22 or 24), A. m. malleensis Gullan (2n =6, 20, 22, 24 or 26), and A. m. munita (Schrader) (2n=54 or >100). Apiomorpha munita appears to occur only on eucalypts of the informal subgenus Symphyomyrtus, with each of the subspecies of A. munita restricted to discrete symphyomyrt sections. Several different karyotypic forms within each subspecies of A. munita appear to be restricted to only one or a few eucalypt species or series. The association between apparent host specificity and chromosomal rearrangements in A. munita suggests that both may be playing an active role in taxon divergence in Apiomorpha. (C) 2001 The Linnean Society of London.
Resumo:
The Sec1p-like/Munc18 (SM) protein Munc18a binds to the neuronal t-SNARE Syntaxin1A and inhibits SNARE complex assembly. Tomosyn, a cytosolic Syntaxin1A-binding protein, is thought to regulate the interaction between Syntaxin1A and Munc18a, thus acting as a positive regulator of SNARE assembly. In the present study we have investigated the interaction between b-Tomosyn and the adipocyte SNARE complex involving Syntaxin4/SNAP23/VAMP-2 and the SM protein Munc18c, in vitro, and the potential involvement of Tomosyn in regulating the translocation of GLUT4 containing vesicles, in vivo. Tomosyn formed a high affinity ternary complex with Syntaxin4 and SNAP23 that was competitively inhibited by VAMP-2. Using a yeast two-hybrid assay we demonstrate that the VAMP-2-like domain in Tomosyn facilitates the interaction with Syntaxin4. Overexpression of Tomosyn in 3T3-L1 adipocytes inhibited the translocation of green fluorescent protein-GLUT4 to the plasma membrane. The SM protein Munc18c was shown to interact with the Syntaxin4 monomer, Syntaxin4 containing SNARE complexes, and the Syntaxin4/Tomosyn complex. These data suggest that Tomosyn and Munc18c operate at a similar stage of the Syntaxin4 SNARE assembly cycle, which likely primes Syntaxin4 for entry into the ternary SNARE complex.
Resumo:
We aimed to study patterns of variation and factors influencing the evolutionary dynamics of a satellite DNA, pBuM, in all seven Drosophila species from the buzzatii cluster (repleta group). We analyzed 117 alpha pBuM-1 (monomer length 190 bp) and 119 composite alpha/beta (370 bp) pBuM-2 repeats and determined the chromosome location and long-range organization on DNA fibers of major sequence variants. Such combined methodologies in the study of satDNAs have been used in very few organisms. In most species, concerted evolution is linked to high copy number of pBuM repeats. Species presenting low-abundance and scattered distributed pBuM repeats did not undergo concerted evolution and maintained part of the ancestral inter-repeat variability. The alpha and alpha/beta repeats colocalized in heterochromatic regions and were distributed on multiple chromosomes, with notable differences between species. High-resolution FISH revealed array sizes of a few kilobases to over 0.7 Mb and mutual arrangements of alpha and alpha/beta repeats along the same DNA fibers, but with considerable changes in the amount of each variant across species. From sequence, chromosomal and phylogenetic data, we could infer that homogenization and amplification events involved both new and ancestral pBuM variants. Altogether, the data on the structure and organization of the pBuM satDNA give insights into genome evolution including mechanisms that contribute to concerted evolution and diversification.
Resumo:
Crustacean color change results from the differential translocation of chromatophore pigments, regulated by neurosecretory peptides like red pigment concentrating hormone (RPCH) that, in the red ovarian chromatophores of the freshwater shrimp Macrobrachium olfersi, triggers pigment aggregation via increased cytosolic cGMP and Ca(2+) of both smooth endoplasmatic reticulum (SER) and extracellular origin. However, Ca(2+) movements during RPCH signaling and the mechanisms that regulate intracellular [Ca(2+)] are enigmatic. We investigate Ca(2+) transporters in the chromatophore plasma membrane and Ca(2+) movements that occur during RPCH signal transduction. Inhibition of the plasma membrane Ca(2+)-ATPase by La(3+) and indirect inhibition of the Na(+)/Ca(2+) exchanger by ouabain induce pigment aggregation, revealing a role for both in Ca(2+) extrusion. Ca(2+) channel blockade by La(3+) or Cd(2+) strongly inhibits slow-phase RPCH-triggered aggregation during which pigments disperse spontaneously. L-type Ca(2+) channel blockade by gabapentin markedly reduces rapid-phase translocation velocity; N- or P/Q-type blockade by omega-conotoxin MVIIC strongly inhibits RPCH-triggered aggregation and reduces velocity, effects revealing RPCH-signaled influx of extracellular Ca(2+). Plasma membrane depolarization, induced by increasing external K(+) from 5 to 50 mM, produces Ca(2+)-dependent pigment aggregation, whereas removal of K(+) from the perfusate causes pigment hyperdispersion, disclosing a clear correlation between membrane depolarization and pigment aggregation; K(+) channel blockade by Ba(2+) also partially inhibits RPCH action. We suggest that, during RPCH signal transduction, Ca(2+) released from the SER, together with K(+) channel closure, causes chromatophore membrane depolarization, leading to the opening of predominantly N- and/or P/Q-type voltage-gated Ca(2+) channels, and a Ca(2+)/cGMP cascade, resulting in pigment aggregation. J. Exp. Zool. 313A:605-617, 2010. (C) 2010 Wiley-Liss, Inc.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Ergosterol is an important compound responsible to maintain integrity and fluidity of Leishmania spp. membranes. Starting from an overexpression/selection method, our group has isolated and mapped nine different loci of Leishmania (L.) major related to resistance against two inhibitors of the ergosterol biosynthesis pathway, terbinafine (TBF) and itraconazole (ITZ). Individual functional analysis after overexpression induction of these loci in the presence of TBF and/or ITZ [or the ITZ analog ketoconazole (CTZ)] have shown low but significant levels of resistance after transfection into L. major wild-type parasites. In this work, we have shown the insert mapping and chromosomal identification of one of these loci (cosItz2). Functional analysis experiments associated with chromosomal localization by comparison at genomic database allowed us to identify two prospective gene-protein systems not related to the ergosterol biosynthesis and capable to confer wild-type cells resistance to ITZ-CTZ after transfection. We expected that this approach can open new insights for a better understanding of mechanisms of ITZ-CTZ action and resistance in Leishmania resulting in new strategies for the leishmaniasis treatment.
Resumo:
Congenital heart disease (CHD) is the most common birth defect and the leading cause of mortality in the first year of life. In fetuses with a heart defect, chromosomal abnormalities are very frequent. Besides aneuploidy, 22q11.2 deletion is one of the most recognizable chromosomal abnormalities causing CHD. The frequency of this abnormality varies in nonselected populations. This study aimed to investigate the incidence of the 22q11.2 deletion and other chromosomal alterations in a Brazilian sample of fetuses with structural cardiac anomalies detected by fetal echocardiography. In a prospective study, 68 fetuses with a heart defect were evaluated. Prenatal detection of cardiac abnormalities led to identification of aneuploidy or structural chromosomal anomaly in 35.3% of these cases. None of the fetuses with apparently normal karyotypes had a 22q11.2 deletion. The heart defects most frequently associated with chromosomal abnormalities were atrioventricular septal defect (AVSD), ventricular septal defect (VSD), and tetralogy of Fallot. Autosomal trisomies 18 and 21 were the most common chromosomal abnormalities. The study results support the strong association of chromosome alterations and cardiac malformation, especially in AVSD and VSD, for which a chromosome investigation is indicated. In fetuses with an isolated conotruncal cardiopathy, fluorescence in situ hybridization (FISH) to investigate a 22q11.2 deletion is not indicated.
Resumo:
The 16q21 -> qter duplication is a chromosomal abnormality rarely found in liveborn infants, with only four published cases. We report here on the 7-year follow-up of a female patient with trisomy 16q21 -> qter due to a maternal balanced translocation t(4;16)(q35.2;q21). The patient shows severe mental retardation, congenital heart malformations, nephropathy, and other congenital anomalies. The derivative chromosome was characterized by GTG banding, fluorescent in situ hybridization (FISH) with different BAG probes and the array technique, in order to map the breakpoints. The patient has a 16q21 -> qter duplication, with a 4q35 -> qter monosomy, which we assume does not contribute to the abnormal phenotype. This is the first reported case of postnatal survival to the age of 7 years, an unusually long time in this chromosomal syndrome. (C) 2010 Wiley-Liss, Inc.
Resumo:
Conventional karyotyping detects anomalies in 3-15% of patients with multiple congenital anomalies and mental retardation (MCA/MR). Whole-genome array screening (WGAS) has been consistently suggested as the first choice diagnostic test for this group of patients, but it is very costly for large-scale use in developing countries. We evaluated the use of a combination of Multiplex Ligation-dependent Probe Amplification (MLPA) kits to increase the detection rate of chromosomal abnormalities in MCA/MR patients. We screened 261 MCA/MR patients with two subtelomeric and one microdeletion kits. This would theoretically detect up to 70% of all submicroscopic abnormalities. Additionally we scored the de Vries score for 209 patients in an effort to find a suitable cut-off for MLPA screening. Our results reveal that chromosomal abnormalities were present in 87 (33.3%) patients, but only 57 (21.8%) were considered causative. Karyotyping detected 15 abnormalities (6.9%), while MLPA identified 54 (20.7%). Our combined MLPA screening raised the total detection number of pathogenic imbalances more than three times when compared to conventional karyotyping. We also show that using the de Vries score as a cutoff for this screening would only be suitable under financial restrictions. A decision analytic model was constructed with three possible strategies: karyotype, karyotype + MLPA and karyotype + WGAS. Karyotype + MLPA strategy detected anomalies in 19.8% of cases which account for 76.45% of the expected yield for karyotype + WGAS. Incremental Cost Effectiveness Ratio (ICER) of MLPA is three times lower than that of WGAS, which means that, for the same costs, we have three additional diagnoses with MLPA but only one with WGAS. We list all causative alterations found, including rare findings, such as reciprocal duplications of regions deleted in Sotos and Williams-Beuren syndromes. We also describe imbalances that were considered polymorphisms or rare variants, such as the new SNP that confounded the analysis of the 22q13.3 deletion syndrome. (C) 2011 Elsevier Masson SAS. All rights reserved.
Resumo:
We present the first comprehensive study, to our knowledge, on genomic chromosomal analysis in syndromic craniosynostosis. In total, 45 patients with craniosynostotic disorders were screened with a variety of methods including conventional karyotype, microsatellite segregation analysis, subtelomeric multiplex ligation-dependent probe amplification) and whole-genome array-based comparative genome hybridisation. Causative abnormalities were present in 42.2% (19/45) of the samples, and 27.8% (10/36) of the patients with normal conventional karyotype carried submicroscopic imbalances. Our results include a wide variety of imbalances and point to novel chromosomal regions associated with craniosynostosis. The high incidence of pure duplications or trisomies suggests that these are important mechanisms in craniosynostosis, particularly in cases involving the metopic suture.