960 resultados para Alpha-synuclein Gene
Resumo:
Mitochondrial impairment is hypothesized to contribute to the pathogenesis of insulin resistance. Mitofusin (Mfn) proteins regulate the biogenesis and maintenance of the mitochondrial network, and when inactivated, cause a failure in the mitochondrial architecture and decreases in oxidative capacity and glucose oxidation. Exercise increases muscle mitochondrial content, size, oxidative capacity and aerobic glucose oxidation. To address if Mfn proteins are implicated in these exercise-induced responses, we measured Mfn1 and Mfn2 mRNA levels, pre-, post-, 2 and 24 h post-exercise. Additionally, we measured the expression levels of transcriptional regulators that control mitochondrial biogenesis and functions, including PGC-1alpha, NRF-1, NRF-2 and the recently implicated ERRalpha. We show that Mfn1, Mfn2, NRF-2 and COX IV mRNA were increased 24 h post-exercise, while PGC-1alpha and ERRalpha mRNA increased 2 h post-exercise. Finally, using in vitro cellular assays, we demonstrate that Mfn2 gene expression is driven by a PGC-1alpha programme dependent on ERRalpha. The PGC-1alpha/ERRalpha-mediated induction of Mfn2 suggests a role of these two factors in mitochondrial fusion. Our results provide evidence that PGC-1alpha not only mediates the increased expression of oxidative phosphorylation genes but also mediates alterations in mitochondrial architecture in response to aerobic exercise in humans
Resumo:
Parkinson's disease (PD) is a slowly progressive neurodegenerative disorder marked by the loss of dopaminergic neurons (in particular in the substantia nigra) causing severe impairment of movement coordination and locomotion, associated with the accumulation of aggregated α-synuclein (α-Syn) into proteinaceous inclusions named Lewy bodies. Various early forms of misfolded α-Syn oligomers are cytotoxic. Their formation is favored by mutations and external factors, such as heavy metals, pesticides, trauma-related oxidative stress and heat shock. Here, we discuss the role of several complementing cellular defense mechanisms that may counteract PD pathogenesis, especially in youth, and whose effectiveness decreases with age. Particular emphasis is given to the 'holdase' and 'unfoldase' molecular chaperones that provide cells with potent means to neutralize and scavenge toxic protein conformers. Because chaperones can specifically recognize misfolded proteins, they are key specificity factors for other cellular defenses, such as proteolysis by the proteasome and autophagy. The efficiency of the cellular defenses decreases in stressed or aging neurons, leading to neuroinflammation, apoptosis and tissue loss. Thus, drugs that can upregulate the molecular chaperones, the ubiquitin-proteasome system and autophagy in brain tissues are promising avenues for therapies against PD and other mutation-, stress- or age-dependent protein-misfolding diseases.
Resumo:
The liver-specific vitellogenin B1 promoter is efficiently activated by estrogen within a nucleosomal environment after microinjection into Xenopus laevis oocytes, consistent with the hypothesis that significant nucleosome remodeling over this promoter is not a prerequisite for the activation by the estrogen receptor (ERalpha). This observation lead us to investigate determinants other than ERalpha of chromatin structure and transcriptional activation of the vitellogenin B1 promoter in this system and in vitro. We find that the liver-enriched transcription factor HNF3 has an important organizational role for chromatin structure as demonstrated by DNase I-hypersensitive site mapping. Both HNF3 and the estrogen receptor activate transcription synergistically and are able to interact with chromatin reconstituted in vitro with three positioned nucleosomes. We propose that HNF3 is the cellular determinant which establishes a promoter environment favorable to a rapid transcriptional activation by the estrogen receptor.
Resumo:
We investigated how synaptic plasticity is related to the neurodegeneration process in the human dorsolateral prefrontal cortex. Pre- and postsynaptic proteins of Brodmann's area 9 from patients with Alzheimer's disease (AD) and age-matched controls were quantified by immunohistochemical methods and Western blots. The main finding was a significant increase in the expression of postsynaptic density protein PSD-95 in AD brains, revealed on both sections and immunoblots, while the expression of spinophilin, associated to spines, remained quantitatively unchanged despite qualitative changes with age and disease. Presynaptic protein alpha-synuclein indicated an increased immunohistochemical level, while synaptophysin remained unchanged. MAP2, a somatodendritic microtubule protein, as well as AD markers such as amyloid-beta protein and phosphorylated protein tau showed an increased expression on immunosections in AD. Altogether these changes suggest neuritic and synaptic reorganization in the process of AD. In particular, the significant increase in PSD-95 expression suggests a change in NMDA receptors trafficking and may represent a novel marker of functional significance for the disease.
Resumo:
Alcoholic liver disease is mediated via activation of TLR4 signaling; MyD88-dependent and -independent signals are important contributors to injury in mouse models. Adiponectin, an anti-inflammatory adipokine, suppresses TLR4/MyD88-dependent responses via induction of heme oxygenase-1 (HO-1). Here we investigated the interactions between chronic ethanol, adiponectin, and HO-1 in regulation of TLR4/MyD88-independent signaling in macrophages and an in vivo mouse model. After chronic ethanol feeding, LPS-stimulated expression of IFN-β and CXCL10 mRNA was increased in primary cultures of Kupffer cells compared with pair-fed control mice. Treatment of Kupffer cells with globular adiponectin (gAcrp) normalized this response. LPS-stimulated IFN-β/CXCL10 mRNA and CXCL10 protein was also reduced in RAW 264.7 macrophages treated with gAcrp or full-length adiponectin. gAcrp and full-length adiponectin acted via adiponectin receptors 1 and 2, respectively. gAcrp decreased TLR4 expression in both Kupffer cells and RAW 264.7 macrophages. Small interfering RNA knockdown of HO-1 or inhibition of HO-1 activity with zinc protoporphyrin blocked these effects of gAcrp. C57BL/6 mice were exposed to chronic ethanol feeding, with or without treatment with cobalt protoporphyrin, to induce HO-1. After chronic ethanol feeding, mice were sensitized to in vivo challenge with LPS, expressing increased IFN-β/CXCL10 mRNA and CXCL10 protein in liver compared with control mice. Pretreatment with cobalt protoporphyrin 24 h before LPS challenge normalized this effect of ethanol. Adiponectin and induction of HO-1 potently suppressed TLR4-dependent/MyD88-independent cytokine expression in primary Kupffer cells from rats and in mouse liver after chronic ethanol exposure. These data suggest that induction of HO-1 may be a useful therapeutic strategy in alcoholic liver disease.
Resumo:
A limited number of receptor tyrosine kinases (e.g., ErbB and fibroblast growth factor receptor families) have been genetically linked to breast cancer development. Here, we investigated the contribution of the Ret receptor tyrosine kinase to breast tumor biology. Ret was expressed in primary breast tumors and cell lines. In estrogen receptor (ER)alpha-positive MCF7 and T47D lines, the ligand (glial-derived neurotrophic factor) activated signaling pathways and increased anchorage-independent proliferation in a Ret-dependent manner, showing that Ret signaling is functional in breast tumor cells. Ret expression was induced by estrogens and Ret signaling enhanced estrogen-driven proliferation, highlighting the functional interaction of Ret and ER pathways. Furthermore, Ret was detected in primary cancers, and there were higher Ret levels in ERalpha-positive tumors. In summary, we showed that Ret is a novel proliferative pathway interacting with ER signaling in vitro. Expression of Ret in primary breast tumors suggests that Ret might be a novel therapeutic target in breast cancer.
Resumo:
AIM: To describe a large family with autosomal dominant parkinsonism. BACKGROUND: Seven genes are directly implicated in autosomally inherited parkinsonism. However, there are several multigenerational large families known with no identifiable mutation. MATERIAL AND METHODS: Family members were evaluated clinically, by history and chart review. Genetic investigation included SCA2, SCA3, UCHL1, SNCA, LRRK2, PINK1, PRKN, PGRN, FMR1 premutation, and MAPT. The proband underwent brain fluorodopa PET (FD-PET) scan, and one autopsy was available. RESULTS: Eleven patients had a diagnosis of Parkinson's disease (PD), nine women. Mean age of onset was 52 with tremor-predominant dopa-responsive parkinsonism. Disease progression was slow but severe motor fluctuations occurred. One patient required subthalamic nucleus deep-brain stimulation with a good motor outcome. One patient had mental retardation, schizophrenia and became demented, and another patient was demented. Three patients and also two unaffected subjects had mild learning difficulties. All genetic tests yielded negative results. FD-PET showed marked asymmetric striatal tracer uptake deficiency, consistent with PD. Pathological examination demonstrated no Lewy bodies and immunostaining was negative for alpha-synuclein. CONCLUSION: Apart from a younger age of onset and a female predominance, the phenotype was indistinguishable from sporadic tremor-predominant PD, including FD-PET scan results. As known genetic causes of autosomal dominant PD were excluded, this family harbors a novel genetic defect.
Resumo:
In this study, we epidemiologically investigated on clinical isolates of Arthroderma benhamiae from humans and animals in Japan by internal transcribed spacer (ITS) region sequence analysis and mating type (MAT)-specific PCR. Seven of 8 A. benhamiae isolates from a human, rabbits and guinea pigs were identified as group I (white phenotype) by morphological characters and ITS region sequence analysis. One strain isolated from a degus (Octodon degus) produced colonies with few irregular folds and yellow velvety mycelium without macro- and microconidia. This strain resembled to group II (yellow phenotype) strain. ITS sequence analysis was also 100 % identical to that of group II. MAT-specific PCR indicated that 6 of these 7 isolates of group I contained an alpha-box gene and that one strain contained high-mobility-group (HMG) gene. One strain of group II was revealed to have an alpha-box gene and no HMG gene. To our knowledge, it is the first A. benhamiae isolate of group II found in Japan. The A. benhamiae may be more widespread in worldwide than our surpassing what is common or usual or expected.
Resumo:
We report a case in which the interaction of heterozygosis for both the ß0-IVS-II-1 (G->A) mutation and the aaaanti-3.7 allele was the probable cause for the clinical occurrence of thalassemia intermedia. The propositus, a 6-year-old Caucasian Brazilian boy of Portuguese descent, showed a moderately severe chronic anemia in spite of having the ß-thalassemia trait. Investigation of the alpha-globin gene status revealed heterozygosis for alpha-gene triplication (aaa/aa). The patient's father, also presenting mild microcytic and hypochromic anemia, had the same alpha and ß genotypes as his son, while the mother, not related to the father and hematologically normal, was also a carrier of the aaaanti-3.7 allele. The present case emphasizes the need for considering the possibility of alpha-gene triplication in ß-thalassemia heterozygotes who display an unexpected severe phenotype. The ß-thalassemia mutation found here is being described for the first time in Brazil.
Resumo:
Le trouble comportemental en sommeil paradoxal (TCSP) se caractérise par une perte de l’atonie musculaire en sommeil paradoxal et par des manifestations motrices élaborées souvent associées au contenu onirique. Le TCSP peut apparaître sous une forme idiopathique (TCSPi), mais il est fréquemment lié à certains désordres neurodégénératifs, dont les synucléinopathies. Des marqueurs biologiques des synucléinopathies, tels que la présence d’anomalies au plan de la motricité, de la détection des odeurs ainsi que de la discrimination des couleurs, ont été retrouvés dans le TCSPi. De plus, des perturbations de l’activité cérébrale en neuroimagerie ainsi que du fonctionnement cognitif ont été observées chez ces patients. Des études ont démontré que le TCSPi pouvait précéder l’apparition d’une maladie de Parkinson (MP) ou d’une démence à corps de Lewy (DCL). Ceci suggère que le TCSPi représenterait un facteur de risque des synucléinopathies. L’objectif principal du présent projet est d’étudier les anomalies du débit sanguin cérébral régional (DSCr) de repos avec la tomographie par émission monophotonique (TEM) dans le TCSPi. Deux études ont été réalisées. La première visait à comparer le DSCr entre des patients avec un TCSPi et des sujets sains, puis d’explorer la relation entre l’activité cérébrale et la présence de marqueurs biologiques des synucléinopathies. Les résultats ont montré une diminution de la perfusion cérébrale dans les régions frontales et pariétales ainsi qu’une augmentation de la perfusion au niveau du pont, du putamen et des hippocampes chez les patients avec un TCSPi. Une relation significative entre la performance des sujets avec un TCSPi à une épreuve de discrimination des couleurs et la perfusion cérébrale au niveau des régions frontales et occipitales a été mise en évidence. Dans l’ensemble, ces résultats ont démontré des anomalies du DSCr chez les patients avec un TCSPi qui sont similaires à celles observées par d’autres études en neuroimagerie dans la MP. Ceci suggère des atteintes neuroanatomiques semblables entre ces pathologies. La seconde étude en TEM a été effectuée dans le but d’examiner les modifications du DSCr associées aux perturbations du fonctionnement cognitif dans le TCSPi. Pour ce faire, le DSCr a été comparé entre un sous-groupe de patients avec un TCSPi et un trouble cognitif léger (TCL), un sous-groupe de patients avec un TCSPi sans TCL et un groupe de sujets sains. Les résultats ont montré que seuls les patients avec un TCSPi et un TCL présentaient une diminution de la perfusion cérébrale dans les aires corticales postérieures (occipitales et temporo-pariétales). Ces observations sont similaires à celles rapportées dans la MP avec démence et la DCL dans les études en neuroimagerie. En conclusion, les résultats de ces deux études ont montré des perturbations du DSCr dans le TCSPi, similaires à celles observées dans les synucléinopathies. Par ailleurs, nos résultats ont mis en évidence que les patients avec un TCSPi et un TCL présentaient les mêmes anomalies de la perfusion cérébrale que les patients avec une MP avec démence et/ou une DCL. La présence de tels marqueurs des synucléinopathies dans le TCSPi suggère que ces patients pourraient être plus à risque d’évoluer vers ce type de maladie neurodégénérative.
Resumo:
Gibberella moniliformis is most commonly associated with maize worldwide and produces high levels of fumonisins, some of the most agriculturally important mycotoxins. Studies demonstrate that molecular methods can be helpful for a rapid identification of Fusarium species and their levels of toxin production. The purpose of this research was to apply molecular methods (AFLP, TEF-1 alpha partial gene sequencing and PCR based on MAT alleles) for the identification of Fusarium species isolated from Brazilian corn and to verify if real time RT-PCR technique based on FUM1 and FUM19 genes is appropriated to estimate fumonisins B(1) and B(2) production levels. Among the isolated strains, 96 were identified as Fusarium verricillioides, and four as other Fusarium species. Concordant phylogenies were obtained by AFLP and TEF-1 alpha sequencing, permitting the classification of the different species into distinct clades. Concerning MAT alleles, 70% of the F. verricillioides isolates carried the MAT-1 and 30% MAT-2. A significant correlation was observed between the expression of the genes and toxin production r=0.95 and r=0.79 (correlation of FUM1 with FB(1) and FB(2), respectively, P < 0.0001): r=0.93 and r =0.78 (correlation of FUM19 with FB(1) and FB(2). respectively, P < 0.0001). Molecular methods used in this study were found to be useful for the rapid identification of Fusarium species. The high and significant correlation between FUM1 and FUM19 expression and fumonisins production suggests that real time RT-PCR is suitable for studies considering the influence of abiotic and biotic factors on expression of these genes. This is the first report concerning the expression of fumonisin biosynthetic genes in Fusarium strains isolated from Brazilian agricultural commodity. (c) 2010 Elsevier B.V. All rights reserved.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
While many members of the black yeasts genus Cladophialophora have been reported to cause diseases in humans, understanding of their natural niche is frequently lacking. Some species can be recovered from the natural environment by means of selective isolation techniques. The present study focuses on a Cladophialophora strain that caused an interdigital tinea nigra-like lesion in a HIV-positive Brazilian child. The fungal infection was successfully treated with oxiconazole. Similar strains had been recovered from the environment in Brazil, Uruguay and the Netherlands. The strains were characterized by sequencing the Internal Transcribed Spacer (ITS) regions and the small subunit (SSU) of the nuclear ribosomal RNA gene, as well as the elongation factor 1-alpha (EF1) gene. Since no match with any known species was found, it is described as the new species, Cladophialophora saturnica.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)