Intermittierende oder Persistierende Rhinitis bei Kindern und Jugendlichen mit Asthma: «The Swiss LARA paediatrics survey [Intermittent or persistent rhinitis in children and adolescents with Asthma: «the Swiss LARA paediatrics survey»].

Asthma and allergic rhinitis are chronic inflammatory airway diseases which often occur concomitantly. The objective of the LARA program was to identify the comorbidities and characteristics of asthma (A), intermittent or persistent rhinitis (IPR) and physician defined atopic dermatitis (AD) in 6- to 16-year old asthmatic Swiss children and adolescents. Overall, 126 general practitioners and paediatricians collected the data of 670 asthmatics. Approximately one third of the asthmatic children in Switzerland had well-controlled asthma. Almost two thirds of these asthmatics suffered from concomitant IPR. The latter presented with significantly less symptoms while the treatment rates with inhaled corticosteroids (approximately 90%) and leukotriene-receptorantagonists (approximately 50%) were comparable. However, there were almost twice as many passive smokers in the less well-controlled group. The prevalence of AD was similar in both groups. IPR and AD may play an important role as risk factors in the future development of asthma.

Psoriasis triggered by toll-like receptor 7 agonist imiquimod in the presence of dermal plasmacytoid dendritic cell precursors.

BACKGROUND: It has been proposed that the innate immune system plays a central role in driving the autoimmune T-cell cascade leading to psoriasis; however, there is no direct evidence for this. OBSERVATIONS: We observed aggravation and spreading of a psoriatic plaque when treated topically with the toll-like receptor (TLR) 7 agonist imiquimod. The exacerbation of psoriasis was accompanied by a massive induction of lesional type I interferon activity, detected by MxA expression after imiquimod therapy. Since imiquimod induces large amounts of type I interferon production from TLR7-expressing plasmacytoid dendritic cell precursors (PDCs), the natural interferon-producing cells of the peripheral blood, we asked whether PDCs are present in psoriatic skin. We identified high numbers of PDCs in psoriatic skin lesions (up to 16% of the total dermal infiltrate) based on their coexpression of BDCA2 and CD123. By contrast, PDCs were present at very low levels in atopic dermatitis and not detected in normal human skin. CONCLUSIONS: This study shows that psoriasis can be driven by the innate immune system through TLR ligation. Furthermore, our finding that large numbers of PDCs infiltrate psoriatic skin suggests a role of lesional PDCs as type I interferon-producing targets for the TLR7 agonist imiquimod.

Cerebriforms cells in cerebrum: an unusual finding

Background. Mycosis Fungoides (MF) is the most common cutaneous T-cell lymphoma, and large cell trasformation (tMF) is an adverse prognostic event. Extra-cutaneous dissemination can occur in the course of the disease, but dissemination to the central nervous system (CNS) is uncommon. Moreover, CNS lymphomas are overall rare and most often of B-cell phenotype. We report a case of CNS large T-cell lymphoma presenting as multiple cerebral lesions in a patient with a history of MF. Methods. We report a case of a 33-year-old woman, known since the age of 16 for erythematous plaques thought to be atopic dermatitis, who developed, end 2012, multiple nodular skin lesions and peripheral adenopathies. Two skin lesions were biopsied simultaneously, and diagnosed as MF and tMF. A lymph node biopsy showed dermatopathic changes without lymphoma (Stage IIB). She received local treatment (UVB, PUVA and radiation therapy) and interferon therapy, and experienced almost complete remission. In 2015 neurological symptoms lead to evidence multiple cerebral lesions, suspicious for lymphoma, evaluated by stereotaxic biopsies. We compared histopathological and molecular features of these with previous skin specimens. After negative bone marrow staging biopsy, she was recently started on chemotherapy (MATRIX). Short follow-up shows rapidly worsening clinical conditions. Results. One of the initial skin biopsies showed atypical lymphoid cells with epidermotropism, Pautrier abcesses and CD4+ CD30- phenotype; the other revealed diffuse dermal infiltration by predominantly large cerebriform tumor cells with high proliferative fraction, and CD2−CD3 −CD4+/−CD7−CD30+ALK- EMA- non-cytotoxic immunophenotype. Altogether, these results led us to diagnose MF and tMF, respectively. The brain was infiltrated by large atypical lymphoid cells with cerebriform nuclei, somewhat anaplastic features and perivascular distribution. By immunohistochemistry, tumor cells were highly proliferative, with a CD2−CD3+CD5−CD7+CD30+ activated cytotoxic immunophenotype. A diagnosis of CD30+ cytotoxic peripheral T-cell lymphoma was retained. TRG and TRB clonality analyses revealed clonal rearrangements in skin and CNS biopsies, with identical patterns in both skin specimens but only minimally overlapping profiles when compared to the CNS sample. Der Pathologe 6 ? 2015 | 633 Conclusions. The reported case illustrates an uncommon finding of a CNS T-cell lymphoma in a patient with previous MF, questioning the clonal relationship between the two diseases and challenging the adequate classification of this CNS lymphoma as either a progression or a de novo lymphoma. Despite differences in immunophenotype and clonality patterns, this CNS lymphoma could possibly represent an aggressive divergent evolution of a primary cutaneous T-cell lymphoma. Additional sequencing is ongoing to try to solve the question.

An Infant with Food Allergy and Eczema in the Family – The Mental and Economic Burden of Caring

Allergic diseases including food allergy and eczema in an infant in combination with the everyday activities of caring for a family will pose challenges to parents. Only fragments of these challenges are revealed to health care professionals. Families have varying mental, social and economic resources to help them care for an allergic infant, and all such resources are important in determining how families succeed in meeting these challenges and the quality of the infant’s care. This study evaluated the whole burden to the family caused by an infant's allergic disease during the first 24 months of life. As the primary caregiver during this period is usually the mother, her perspective was considered important. Ecocultural theory, which considers families as capable of modifying the positive and negative forces facing them, was taken as the frame of reference. Data were collected as part of an ongoing prospective mother-infant study, and the methods included severity scoring of atopic dermatitis, dietary records, health-related quality of life measurements and assessments of the use of health care services and medications for treating the infant’s eczema, food allergy and asthma. Interviews with mothers were analysed by deductive content analysis on the basis of ecocultural theory and the family empowerment model. The theme “Living an ordinary family life” guided the organization of family activities essential for treating the infant's food allergy and eczema. These activities were sources of both strain and support for the mothers, the allergy-related supporting factors being the mother’s own knowledge of the allergy, hopes for an improvement in the infant’s condition, social support and work. An infant’s food allergy at the age of one year caused considerable strain for the mother in cases where the introduction of new foods into the child’s diet was delayed. This delay was still causing the mother additional strain when the child was 24 months of age. The infants waking at night at the ages of 12 and 24 months because of itching related to eczema caused strain for the mothers. The infants’ health-related quality of life was impaired at ages of 6 and 12 months compared with healthy infants. The principal reasons for impairments were itching, scratching and sleep disturbances at 6 and 12 months and treatment difficulties at 6 months. Problems with getting to sleep were reported at all stages irrespective of eczema and were also present in healthy infants. The economic impact of the treatment of allergic diseases on families during the first 24 months was 131 EUR (2006 value) in cases of eczema and 525 EUR in cases of food allergy. From the societal perspective, the costs of food allergy were a median of 3183 EUR (range 628–11 560 EUR) and of eczema a median of 275 EUR (range 94–1306 EUR). These large variations in costs in food allergy and eczema indicate that disease varies greatly . In conclusion, food allergy and eczema cause extra activities and costs to families which arrange these disease-related activities in such a way that they support the leading family theme “Living an ordinary family life”. Health care professionals should consider this thematic character of family life and disease-related activities in order to ensure that new treatments are sustainable, meaningful and tailored to daily activities. In addition, those mothers who are experiencing difficulties with food allergic infants or infants with eczema should be recognized early and provided with individual encouragement and support from health clinics. In the light of the present results, early detection of symptoms and effective parental guidance can contribute to the well-being and health-related quality of life of the child and family.

Evidence for the participation of nitric oxide in pemphigus

Pemphigus is an inflammatory autoimmune disorder of the skin. Nitric oxide (NO) is an inflammatory mediator linked to a variety of physiological and pathophysiological phenomena that include skin tumors, psoriasis, urticaria, and atopic dermatitis. Inflammatory cells present in pemphigus lesions are important sources of NO production. We investigated whether NO is involved in pemphigus. A prospective cohort study was conducted at the Dermatology Service of the Hospital Universitário Walter Cantídio of the Federal University of Ceará. All patients seen at the outpatient clinic between August 2000 and July 2001, with a clinically and histologically confirmed diagnosis of pemphigus were included. The median age was 42.5 years (range: 12-69 years) with a male to female ratio of 3:2. Total serum nitrite levels, used as a marker for NO production, were determined by the Griess reaction. Skin biopsies from pemphigus and breast surgery (control) patients were used for the detection of the inducible NO synthase (iNOS) by immunohistochemistry. Twenty-two (22) patients with pemphigus and eight (8) controls who did not differ in demographic characteristics were included. Total serum nitrite levels were significantly higher (>7 µmol/L) in pemphigus patients compared to controls (<6 µmol/L), regardless of the severity of the clinical activity of pemphigus (P < 0.0001). All pemphigus biopsies presented increased immunostaining for iNOS that was not detected in normal skin samples. These data are the first to demonstrate that pemphigus patients display increased serum NO levels that are associated with increased iNOS expression in the affected skin.

Cloning, bioinformatics analysis, and expression of the dust mite allergen Der f 5 of Dermatophagoides farinae

Crude extracts of house dust mites are used clinically for diagnosis and immunotherapy of allergic diseases, including bronchial asthma, perennial rhinitis, and atopic dermatitis. However, crude extracts are complexes with non-allergenic antigens and lack effective concentrations of important allergens, resulting in several side effects. Dermatophagoides farinae (Hughes; Acari: Pyroglyphidae) is one of the predominant sources of dust mite allergens, which has more than 30 groups of allergen. The cDNA coding for the group 5 allergen of D. farinae from China was cloned, sequenced and expressed. According to alignment using the VECTOR NTI 9.0 software, there were eight mismatched nucleotides in five cDNA clones resulting in seven incompatible amino acid residues, suggesting that the Der f 5 allergen might have sequence polymorphism. Bioinformatics analysis revealed that the matured Der f 5 allergen has a molecular mass of 13604.03 Da, a theoretical pI of 5.43 and is probably hydrophobic and cytoplasmic. Similarities in amino acid sequences between Der f 5 and allergens of other domestic mite species, viz. Der p 5, Blo t 5, Sui m 5, and Lep d 5, were 79, 48, 53, and 37%, respectively. Phylogenetic analysis indicated that Der f 5 and Der p 5 clustered together. Blo t 5 and Ale o 5 also clustered together, although Blomia tropicalis and Aleuroglyphus ovatus belong to different mite families, viz. Echimyopodidae and Acaridae, respectively.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Nanopartículas de PCL com acetato de hidrocortisona como uma terapia dermatológica inovadora para a dermatite atópica

A dermatite atópica é uma patologia cutânea crónica que requer cuidados intensivos da pele e tratamento farmacológico; contudo, os tratamentos disponíveis necessitam urgentemente de ser melhorados, especialmente quando utilizados por períodos longos ou em grupos específicos (ex: crianças). A nanotecnologia tem contribuído com sistemas de veiculação inovadores e pode oferecer terapias efectivas e direcionadas. Os objectivos deste estudo centraram-se na preparação caracterização das nanopartículas de policaprolactona carregadas com acetato de hidrocortisona em termos das propriedades físico-químicas, eficiência de encapsulação, ensaios de libertação in vitro e ensaios de segurança dos excipientes utilizados em voluntários humanos. As nanopartículas produzidas apresentaram um tamanho médio de 258,4 24,5 nm e um índice de polidispersão de 0,084. O potencial zeta foi -4,39 0,62 mV e a eficiência de encapsulação foi 36,32 0,03 %. A libertação in vitro do fármaco foi controlada ao longo do tempo. Além disso, os testes de segurança indicaram que os excipientes foram bem tolerados. Este estudo demonstra que as nanopartículas de policaprolactona são sistemas estáveis para veiculação de acetato de hidrocortisona que poderão conduzir a uma libertação prolongada do fármaco, com resultados promissores ao nível da sua segurança quando aplicados na pele humana.

Modelo tipo de dermatite atópica em rato

A dermatite atópica (DA) é um tema importante na dermatologia clínica. Na verdade, a patogénese dessa doença inflamatória crónica da pele, caracterizada principalmente por pele seca e prurido, ainda está longe de ser totalmente compreendida. A fim de saber mais acerca desta complexa doença, ratos Wistar machos e adultos (n = 10) foram utilizados como modelo animal, nos quais o tratamento com acetona (AA) foi comparado com o tratamento com água por 3 dias (AW). No dia 3, uma hora após o último tratamento, a AA mostrou maior perda transepidérmica de água (TEWL), fluxo sanguíneo capilar e reduzida hidratação quando comparada com AW. A análise comportamental mostrou que a acção de coçar foi marcadamente mais frequente no grupo AA (n = 5) quando comparado ao grupo AW (n = 5). Estes resultados justificam a implementação deste modelo animal como uma ferramenta experimental para investigação da AD.

Dermatoses das crianças e resposta cosmetodológica

A pele infantil apresenta diferentes características quando comparada com a dos adultos, apresenta-se mais fina, permeável e delicada devido à imaturidade das suas estruturas. Desta forma, as crianças são mais susceptíveis ao desenvolvimento de várias afecções cutâneas, as dermatoses, tais como a dermatite das fraldas, dermatite atópica, miliária, psoríase, entre outras. Actualmente existe uma grande variedade de produtos cosméticos que se destinam a serem utilizados em crianças e até mesmo em recém-nascidos, estes são desenvolvidos a pensar nas características próprias da pele infantil. Todos os produtos que entram em contacto com a pele do bebé devem ser rigorosamente seleccionados. Com este trabalho pretende-se abordar as diversas dermatoses que afectam as crianças tais com as opções cosmetológicas existentes para o tratamento das mesmas.

Potential roles and clinical utility of prebiotics in newborns, infants, and children: proceedings from a global prebiotic summit meeting, New York City, June 27-28, 2008

Initial bacterial colonization, including colonization with health-positive bacteria, such as bifidobacteria and lactobacilli, is necessary for the normal development of intestinal innate and adaptive immune defenses. The predominance of beneficial bacteria in the gut microflora of breast-fed infants is thought to be, at least in part, supported by the metabolism of the complex mixture of oligosaccharides present in human breast milk, and a more adult-type intestinal microbiota is found in formula-fed infants. Inadequate gut colonization, dysbiosis, may lead to an increased risk of infectious, allergic, and autoimmune disorders later in life. The addition of appropriate amounts of selected prebiotics to infant formulas can enhance the growth of bifidobacteria or lactobacilli in the colonic microbiota and, thereby, might produce beneficial effects. Among the substrates considered as prebiotics are the oligosaccharides inulin, fructo-oligosaccharides, galacto-oligosaccharides, and lactulose. There are some reports that such prebiotics have beneficial effects on various markers of health. For example, primary prevention trials in infants have provided promising data on prevention of infections and atopic dermatitis. Additional well-designed prospective clinical trials and mechanistic studies are needed to advance knowledge further in this promising field. (J Pediatr 2009;155:S61-70).

Current level of consensus on probiotic science: report of an expert meeting, London, 23 November 2009

The present paper summarizes  the consensus views of a group of 9 European clinicians and scientists on the current state of scientific knowledge on probiotics, covering those areas where there is substantial evidence for beneficial effects and those  where the evidence base is poor or inconsistent. There was general agreement that probiotic effects were species and often strain specific. The experts agreed  that some probiotics were effective in reducing the incidence and duration of rotavirus diarrhoea in infants, antibiotic-associated diarrhoea in adults and, for certain probiotics, Clostridium difficile infections. Some probiotics are associated with symptomatic improvements in irritable bowel syndrome and alleviation of digestive discomfort. Probiotics can reduce the frequency and severity of necrotizing enterocolitis in premature infants and have been shown to regulate intestinal immunity.  Several other clinical effects of probiotics, including their role in inflammatory bowel disease, atopic dermatitis, respiratory or genito-urinary infections or H.pylori adjuvant treatment were thought promising but inconsistent.

Using pH abnormalities in diseased skin to trigger and target topical therapy

Abstract Purpose: The pH discrepancy between healthy and atopic dermatitis skin was identified as a site specific trigger for delivering hydrocortisone from microcapsules. Methods: Using Eudragit L100, a pH-responsive polymer which dissolves at pH 6, hydrocortisone-loaded microparticles were produced by oil-in-oil microencapsulation or spray drying. Release and permeation of hydrocortisone from microparticles alone or in gels was assessed and preliminary stability data was determined. Results: Drug release from microparticles was pH-dependent though the particles produced by spray drying also gave significant non-pH dependent burst release, resulting from their porous nature or from drug enrichment on the surface of these particles. This pH-responsive release was maintained upon incorporation of the oil-in-oil microparticles into Carbopol- and HPMC-based gel formulations. In-vitro studies showed 4 to 5-fold higher drug permeation through porcine skin from the gels at pH 7 compared to pH 5. Conclusions: Permeation studies showed that the oil-in-oil generated particles deliver essentially no drug at normal (intact) skin pH (5.0 – 5.5) but that delivery can be triggered and targeted to atopic dermatitis skin where the pH is elevated. The incorporation of these microparticles into Carbopol- and HPMC-based aqueous gel formulations demonstrated good stability and pH-responsive permeation into porcine skin.

Malassezia spp. in acoustic meatus of bats (Molossus molossus) of the Amazon region, Brazil

The yeasts of the Malassezia genus are opportunistic microorganisms and can cause human and animal infections. They are commonly isolated from the skin and auricular canal of mammalians, mainly dogs and cats. The present study was aimed to isolate Malassezia spp. from the acoustic meatus of bats (Molossus molossus) in the Montenegro region, `` Rondonia ``, Brazil. From a total of 30 bats studied Malassezia spp. were isolated in 24 (80%) animals, the breakdown by species being as follows (one Malassezia sp. per bat, N=24): 15 (62.5%) M. pachydermatis, 5 (20.8%) M. furfur, 3 (12.5%) M. globosa and 1 (4.2%) M. sympodialis. This study establishes a new host and anatomic place for Malassezia spp., as it presents the first report ever of the isolation of this genus of yeasts in the acoustic meatus of bats.

Thermal analysis of prednicarbate and characterization of thermal decomposition product

In the present work, the thermal behavior of prednicarbate was studied using DSC and TG/DTG. The solid product remaining at the first decomposition step of the drug was isolated by TG, in air and N(2) atmospheres and was characterized using LC-MS/MS, NMR, and IR spectroscopy. It was found that the product at the first thermal decomposition step of prednicarbate corresponds to the elimination of the carbonate group bonding to C(17), and a consequent formation of double bond between C(17) and C(16). Structure elucidation of this degradation product by spectral data has been discussed in detail.