Transplantation of muscle-derived stem cells plus biodegradable fibrin glue restores the urethral sphincter in a pudendal nerve-transected rat model

We investigated whether fibrin glue (FG) could promote urethral sphincter restoration in muscle-derived stem cell (MDSC)-based injection therapies in a pudendal nerve-transected (PNT) rat, which was used as a stress urinary incontinence (SUI) model. MDSCs were purified from the gastrocnemius muscles of 4-week-old inbred female SPF Wistar rats and labeled with green fluorescent protein. Animals were divided into five groups (N = 15): sham (S), PNT (D), PNT+FG injection (F), PNT+MDSC injection (M), and PNT+MDSC+FG injection (FM). Each group was subdivided into 1- and 4-week groups. One and 4 weeks after injection into the proximal urethra, leak point pressure (LPP) was measured to assess urethral resistance function. Histology and immunohistochemistry were performed 4 weeks after injection. LPP was increased significantly in FM and M animals after implantation compared to group D (P < 0.01), but was not different from group S. LPP was slightly higher in the FM group than in the M group but there was no significant difference between them at different times. Histological and immunohistochemical examination demonstrated increased numbers of surviving MDSCs (109 ± 19 vs 82 ± 11/hpf, P = 0.026), increased muscle/collagen ratio (0.40 ± 0.02 vs 0.34 ± 0.02, P = 0.044), as well as increased microvessel density (16.9 ± 0.6 vs 14.1 ± 0.4/hpf, P = 0.001) at the injection sites in FM compared to M animals. Fibrin glue may potentially improve the action of transplanted MDSCs to restore the histology and function of the urethral sphincter in a SUI rat model. Injection of MDSCs with fibrin glue may provide a novel cellular therapy method for SUI.

Prognosis of colorectal cancer with liver metastasis: value of a prognostic index

The objective of the present study was to explore the factors related to the prognosis of colorectal cancer (CRC) and to establish a prognostic model for the selection of patients who might benefit from hepatic resection for metastatic CRC. A total of 293 patients undergoing liver resection for metastatic CRC (172 males and 80 females ranging in age from 26 to 80 years) were selected and clinical, pathological and outcome data were examined in this retrospective study. The prognostic index (PI) of the patients was calculated on the basis of results of multivariate analysis. Patients were stratified into different groups, with survival curves projected according to PI. The 1-, 3-, and 5-year overall survival rates were 58.3, 26.4, and 11.3%, respectively. Univariate analysis indicated that degree of primary tumor differentiation, resection margin, preoperative carcinoembryonic antigen (CEA) level, number of liver metastases, and resection of liver metastases were associated with prognosis (P < 0.05). In multivariate analysis, the last three factors were found to be independent prognostic factors. The resection of liver metastases was a favorable factor. Patients were classified into three groups according to PI, which differed significantly in survival rate (P < 0.05). The individual survival rate was evaluated based on PI. Resection of hepatic colorectal metastases may produce long-term survival and cure. The proposed PI was easy to use, was highly predictive of patient outcome, and permitted categorization of patients into treatment groups.

Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

A high-carbohydrate diet enhances the adverse effect of the S2 allele of APOC3 SstI polymorphism on the TG/HDL-C ratio only in young Chinese females

Both genetic background and diet have profound effects on plasma lipid profiles. We hypothesized that a high-carbohydrate (high-CHO) diet may affect the ratios of serum lipids and apolipoproteins (apo) differently in subjects with different genotypes of the SstI polymorphism in the apoCIII gene (APOC3). Fifty-six healthy university students (27 males and 29 females, 22.89 ± 1.80 years) were given a washout diet of 54% carbohydrate for 7 days, followed by a high-CHO diet of 70% carbohydrate for 6 days without total energy restriction. Serum triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), apoB100, apoAI, and the APOC3 SstI polymorphism were analyzed. The ratios of serum lipids and apoB100/apoAI were calculated. At baseline, the TG/HDL-C ratio was significantly higher in females, but not in males, with the S2 allele. The differences in the TG/HDL-C ratio between genotypes remained the same after the washout and the high-CHO diet in females. When compared with those before the high-CHO diet, the TC/HDL-C (male S2 carriers: 3.13 ± 1.00 vs 2.36 ± 0.65, P = 0.000; male subjects with the S1S1 genotype: 2.97 ± 0.74 vs 2.09 ± 0.55, P = 0.000; female S2 carriers: 2.68 ± 0.36 vs 2.24 ± 0.37, P = 0.004; female subjects with the S1S1 genotype: 2.69 ± 0.41 vs 2.09 ± 0.31, P = 0.000) and LDL-C/HDL-C (male S2 carriers: 1.44 ± 0.71 vs 1.06 ± 0.26, P = 0.012; male subjects with the S1S1 genotype: 1.35 ± 0.61 vs 1.01 ± 0.29, P = 0.005; female S2 carriers: 1.18 ± 0.33 vs 1.00 ± 0.18, P = 0.049; female subjects with the S1S1 genotype: 1.18 ± 0.35 vs 1.04 ± 0.19, P = 0.026) ratios were significantly decreased after the high-CHO diet regardless of gender and of genotype of the APOC3 SstI polymorphism. However, in female S2 carriers, the TG/HDL-C (1.38 ± 0.46 vs 1.63 ± 0.70, P = 0.039) ratio was significantly increased after the high-CHO diet. In conclusion, the high-CHO diet has favorable effects on the TC/HDL-C and LDL-C/HDL-C ratios regardless of gender and of genotype of the APOC3 SstI polymorphism. Somehow, it enhanced the adverse effect of the S2 allele on the TG/HDL-C ratio only in females.

Serum metabolic profiling of human gastric cancer based on gas chromatography/mass spectrometry

Research on molecular mechanisms of carcinogenesis plays an important role in diagnosing and treating gastric cancer. Metabolic profiling may offer the opportunity to understand the molecular mechanism of carcinogenesis and help to non-invasively identify the potential biomarkers for the early diagnosis of human gastric cancer. The aims of this study were to explore the underlying metabolic mechanisms of gastric cancer and to identify biomarkers associated with morbidity. Gas chromatography/mass spectrometry (GC/MS) was used to analyze the serum metabolites of 30 Chinese gastric cancer patients and 30 healthy controls. Diagnostic models for gastric cancer were constructed using orthogonal partial least squares discriminant analysis (OPLS-DA). Acquired metabolomic data were analyzed by the nonparametric Wilcoxon test to find serum metabolic biomarkers for gastric cancer. The OPLS-DA model showed adequate discrimination between cancer and non-cancer cohorts while the model failed to discriminate different pathological stages (I-IV) of gastric cancer patients. A total of 44 endogenous metabolites such as amino acids, organic acids, carbohydrates, fatty acids, and steroids were detected, of which 18 differential metabolites were identified with significant differences. A total of 13 variables were obtained for their greatest contribution in the discriminating OPLS-DA model [variable importance in the projection (VIP) value >1.0], among which 11 metabolites were identified using both VIP values (VIP >1) and the Wilcoxon test. These metabolites potentially revealed perturbations of glycolysis and of amino acid, fatty acid, cholesterol, and nucleotide metabolism of gastric cancer patients. These results suggest that gastric cancer serum metabolic profiling has great potential in detecting this disease and helping to understand its metabolic mechanisms.

Effect of trimetazidine treatment on the transient outward potassium current of the left ventricular myocytes of rats with streptozotocin-induced type 1 diabetes mellitus

Cardiovascular complications are a leading cause of mortality in patients with diabetes mellitus (DM). The present study was designed to investigate the effects of trimetazidine (TMZ), an anti-angina drug, on transient outward potassium current (Ito) remodeling in ventricular myocytes and the plasma contents of free fatty acid (FFA) and glucose in DM. Sprague-Dawley rats, 8 weeks old and weighing 200-250 g, were randomly divided into three groups of 20 animals each. The control group was injected with vehicle (1 mM citrate buffer), the DM group was injected with 65 mg/kg streptozotocin (STZ) for induction of type 1 DM, and the DM + TMZ group was injected with the same dose of STZ followed by a 4-week treatment with TMZ (60 mg·kg-1·day-1). All animals were then euthanized and their hearts excised and subjected to electrophysiological measurements or gene expression analyses. TMZ exposure significantly reversed the increased plasma FFA level in diabetic rats, but failed to change the plasma glucose level. The amplitude of Ito was significantly decreased in left ventricular myocytes from diabetic rats relative to control animals (6.25 ± 1.45 vs 20.72 ± 2.93 pA/pF at +40 mV). The DM-associated Ito reduction was attenuated by TMZ. Moreover, TMZ treatment reversed the increased expression of the channel-forming alpha subunit Kv1.4 and the decreased expression of Kv4.2 and Kv4.3 in diabetic rat hearts. These data demonstrate that TMZ can normalize, or partially normalize, the increased plasma FFA content, the reduced Ito of ventricular myocytes, and the altered expression Kv1.4, Kv4.2, and Kv4.3 in type 1 DM.

In vitro culture and characterization of alveolar bone osteoblasts isolated from type 2 diabetics

In order to understand the mechanisms of poor osseointegration following dental implants in type 2 diabetics, it is important to study the biological properties of alveolar bone osteoblasts isolated from these patients. We collected alveolar bone chips under aseptic conditions and cultured them in vitro using the tissue explants adherent method. The biological properties of these cells were characterized using the following methods: alkaline phosphatase (ALP) chemical staining for cell viability, Alizarin red staining for osteogenic characteristics, MTT test for cell proliferation, enzyme dynamics for ALP contents, radio-immunoassay for bone gla protein (BGP) concentration, and ELISA for the concentration of type I collagen (COL-I) in the supernatant. Furthermore, we detected the adhesion ability of two types of cells from titanium slices using non-specific immunofluorescence staining and cell count. The two cell forms showed no significant difference in morphology under the same culture conditions. However, the alveolar bone osteoblasts received from type 2 diabetic patients had slower growth, lower cell activity and calcium nodule formation than the normal ones. The concentration of ALP, BGP and COL-I was lower in the supernatant of alveolar bone osteoblasts received from type 2 diabetic patients than in that received from normal subjects (P < 0.05). The alveolar bone osteoblasts obtained from type 2 diabetic patients can be successfully cultured in vitro with the same morphology and biological characteristics as those from normal patients, but with slower growth and lower concentration of specific secretion and lower combining ability with titanium than normal ones.

Tissue transglutaminase (TG2) activity regulates osteoblast differentiation and mineralization in the SAOS-2 cell line

Tissue transglutaminase (type II, TG2) has long been postulated to directly promote skeletal matrix calcification and play an important role in ossification. However, limited information is available on the expression, function and modulating mechanism of TG2 during osteoblast differentiation and mineralization. To address these issues, we cultured the well-established human osteosarcoma cell line SAOS-2 with osteo-inductive conditioned medium and set up three time points (culture days 4, 7, and 14) to represent different stages of SAOS-2 differentiation. Osteoblast markers, mineralization, as well as TG2 expression and activity, were then assayed in each stage. Furthermore, we inhibited TG activity with cystamine and then checked SAOS-2 differentiation and mineralization in each stage. The results showed that during the progression of osteoblast differentiation SAOS-2 cells presented significantly high levels of osteocalcin (OC) mRNA, bone morphogenetic protein-2 (BMP-2) and collagen I, significantly high alkaline phosphatase (ALP) activity, and the increased formation of calcified matrix. With the same tendency, TG2 expression and activity were up-regulated. Furthermore, inhibition of TG activity resulted in a significant decrease of OC, collagen I, and BMP-2 mRNA and of ALP activity and mineralization. This study demonstrated that TG2 is involved in osteoblast differentiation and may play a role in the initiation and regulation of the mineralization processes. Moreover, the modulating effects of TG2 on osteoblasts may be related to BMP-2.

TNNI3K is a novel mediator of myofilament function and phosphorylates cardiac troponin I

The phosphorylation of cardiac troponin I (cTnI) plays an important role in the contractile dysfunction associated with heart failure. Human cardiac troponin I-interacting kinase (TNNI3K) is a novel cardiac-specific functional kinase that can bind to cTnI in a yeast two-hybrid screen. The purpose of this study was to investigate whether TNNI3K can phosphorylate cTnI at specific sites and to examine whether the phosphorylation of cTnI caused by TNNI3K can regulate cardiac myofilament contractile function. Co-immunoprecipitation was performed to confirm that TNNI3K could interact with cTnI. Kinase assays further indicated that TNNI3K did not phosphorylate cTnI at Ser23/24 and Ser44, but directly phosphorylated Ser43 and Thr143 in vitro. The results obtained for adult rat cardiomyocytes also indicated that enhanced phosphorylation of cTnI at Ser43 and Thr143 correlated with rTNNI3K (rat TNNI3K) overexpression, and phosphorylation was reduced when rTNNI3K was knocked down. To determine the contractile function modulated by TNNI3K-mediated phosphorylation of cTnI, cardiomyocyte contraction was studied in adult rat ventricular myocytes. The contraction of cardiomyocytes increased with rTNNI3K overexpression and decreased with rTNNI3K knockdown. We conclude that TNNI3K may be a novel mediator of cTnI phosphorylation and contribute to the regulation of cardiac myofilament contraction function.

Identification of microRNAs and mRNAs associated with multidrug resistance of human laryngeal cancer Hep-2 cells

Multidrug resistance (MDR) poses a serious impediment to the success of chemotherapy for laryngeal cancer. To identify microRNAs and mRNAs associated with MDR of human laryngeal cancer Hep-2 cells, we developed a multidrug-resistant human laryngeal cancer subline, designated Hep-2/v, by exposing Hep-2 cells to stepwise increasing concentrations of vincristine (0.02-0.96'µM). Microarray assays were performed to compare the microRNA and mRNA expression profiles of Hep-2 and Hep-2/v cells. Compared to Hep-2 cells, Hep-2/v cells were more resistant to chemotherapy drugs (∼45-fold more resistant to vincristine, 5.1-fold more resistant to cisplatin, and 5.6-fold more resistant to 5-fluorouracil) and had a longer doubling time (42.33±1.76 vs 28.75±1.12'h, P<0.05), higher percentage of cells in G0/G1 phase (80.98±0.52 vs69.14±0.89, P<0.05), increased efflux of rhodamine 123 (95.97±0.56 vs 12.40±0.44%, P<0.01), and up-regulated MDR1 expression. A total of 7 microRNAs and 605 mRNAs were differentially expressed between the two cell types. Of the differentially expressed mRNAs identified, regulator of G-protein signaling 10, high-temperature requirement protein A1, and nuclear protein 1 were found to be the putative targets of the differentially expressed microRNAs identified. These findings may open a new avenue for clarifying the mechanisms responsible for MDR in laryngeal cancer.

The impact of short daily hemodialysis on anemia and the quality of life in Chinese patients

Anemia is a frequent complication in hemodialysis patients. Compared to conventional hemodialysis (CHD), short daily hemodialysis (sDHD) has been reported to be effective in many countries except China. The aim of the present study was to determine whether sDHD could improve anemia and quality of life (QOL) for Chinese outpatients with end-stage renal disease. Twenty-seven patients (16 males/11 females) were converted from CHD to sDHD. All laboratory values were measured before conversion (baseline), at 3 months after conversion (sDHD1), and at 6 months after conversion (sDHD2). The patient's QOL was evaluated at baseline and 6 months after conversion using the Medical Outcomes Study 36-Item Short Form Health Survey (SF-36). Hemoglobin concentration increased significantly from 107.4±7.9 g/L at baseline to 114.4±6.8 g/L (P<0.05) at sDHD1, and 118.3±8.4 g/L (P<0.001) at sDHD2 (Student paired t-test). However, the dose requirement for erythropoietin decreased from 6847.8±1057.3 U/week at baseline to 5869.6±1094.6 U/week (P<0.05) at sDHD2. Weekly stdKt/V increased significantly from 2.05±0.13 at baseline to 2.73±0.20 (P<0.001) at sDHD1, and 2.84±0.26 (P<0.001) at sDHD2. C-reactive protein decreased from baseline to sDHD1 and sDHD2, but without statistically significant differences. Physical and mental health survey scores increased in the 6 months following conversion to sDHD. sDHD may increase hemoglobin levels, decrease exogenous erythropoietin dose requirements, and improve QOL in Chinese hemodialysis patients compared to CHD. A possible mechanism for improvement of clinical outcomes may be optimized management of uremia associated with the higher efficiency of sDHD.

Myocardial remodeling and bioelectric changes in tachycardia-induced heart failure in dogs

In this study, electrical and structural remodeling of ventricles was examined in tachycardia-induced heart failure (HF). We studied two groups of weight-matched adult male mongrel dogs: a sham-operated control group (n=5) and a pacing group (n=5) that underwent ventricular pacing at 230 bpm for 3 weeks. Clinical symptoms of congestive HF were observed in both groups. Their hemodynamic parameters were determined and the severity of the HF was evaluated by M-mode echocardiography. Changes in heart morphology were observed by scanning electron and light microscopy. Ventricular action potential duration (APD), as well as the 50 and 90% APD were measured in both groups. All dogs exhibited clinical symptoms of congestive HF after rapid right ventricular pacing for 3 weeks. These data indicate that rapid, right ventricular pacing produces a useful experimental model of low-output HF in dogs, characterized by biventricular pump dysfunction, biventricular cardiac dilation, and non-ischemic impairment of left ventricular contractility. Electrical and structural myocardial remodeling play an essential role in congestive HF progression, and should thus be prevented.

Measurement of serum estrogen and estrogen metabolites in pre- and postmenopausal women with osteoarthritis using high-performance liquid chromatography-electrospray ionization-tandem mass spectrometry

Although 17β-estradiol (E2) deficiency has been linked to the development of osteoarthritis (OA) in middle-aged women, there are few studies relating other estrogens and estrogen metabolites (EMs) to this condition. We developed a high-performance liquid chromatography-electrospray ionization-tandem mass spectrometry (HPLC-ESI-MS/MS) method to measure the levels of six EMs (i.e., estrone, E2, estriol, 2-hydroxyestrone, 2-hydroxyestradiol, and 16a-hydroxyestrone) in healthy pre- and postmenopausal women and women with OA. This method had a precision ranging from 1.1 to 3.1% and a detection limit ranging from 10 to 15 pg. Compared to healthy women, serum-free E2 was lower in the luteal and postmenopausal phases in women with OA, and total serum E2 was lower in postmenopausal women with OA. Moreover, compared to healthy women, total serum 2-hydroxyestradiol was higher in postmenopausal women with OA and total serum 2-hydroxyestrone was lower in both the luteal and follicular phases in women with OA. In conclusion, our HPLC-ESI-MS/MS method allowed the measurement of multiple biochemical targets in a single assay, and, given its increased cost-effectiveness, simplicity, and speed relative to previous methods, this method is suitable for clinical studies.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Plasma levels and placental expression of vaspin in pregnant women with diabetes mellitus

The present study aimed to investigate visceral adipose tissue-specific serpin (vaspin) concentrations in serum and term placentas and relate these values to insulin resistance and lipid parameters in women with gestational diabetes mellitus (GDM). A total of 30 GDM subjects and 27 age-matched pregnant women with normal glucose tolerance (NGT, control) were included. Serum glucose, glycated hemoglobin (HbA1c), lipid profile, insulin, and vaspin were measured at the end of pregnancy, and homeostasis model of assessment-insulin resistance (HOMA-IR) values were calculated. Vaspin mRNA and protein levels in placentas were measured by real-time fluorescence quantitative reverse transcription polymerase chain reaction (RT-qPCR) and Western blotting, respectively. Serum vaspin levels were significantly lower in the GDM group than in controls (0.49±0.24 vs 0.83±0.27 ng/mL, respectively; P<0.01). Three days after delivery, serum vaspin levels were significantly decreased in subjects with GDM (0.36±0.13 vs0.49±0.24 ng/mL, P<0.01). However, in the GDM group, serum vaspin levels were not correlated with the parameters evaluated. In contrast, in the control group, serum vaspin levels were positively correlated with triglycerides (TG; r=0.45, P=0.02) and very low-density lipoprotein cholesterol (VLDL-C; r=0.42, P=0.03). Placental mRNA vaspin (0.60±0.32 vs0.68±0.32, P=0.46) and protein (0.30±0.08 vs0.39±0.26; P=0.33) levels in the GDM group did not differ significantly from those in the control group, but were negatively correlated with neonatal birth weight in the GDM group (r=-0.48, P=0.03; r=-0.88; P<0.01). Our findings indicated that vaspin may be an important adipokine involved in carbohydrate and lipid metabolism and may also play a role in fetal development.