Evaluation of the Duggan Test for Concretes Made of Different Types of Cements, MLR-97-8, 2000

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Phosphorus in Finnish soils in the 1900s with particular reference to the acid ammonium acetate soil test

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Is it the grain size or the characteristic pore size that controls the induced polarization relaxation time of clean sands and sandstones?

There is a wide range of evidence to suggest that permeability can be constrained through of induced polarization measurements. For clean sands and sandstones, current mechanistic models of induced polarization predict a relationship between the low-frequency time constant inferred from induced polarization measurements and the grain diameter. A number of observations do, however, disagree with this and indicate that the observed relaxation behavior is rather governed by the so-called dynamic pore radius L. To test this hypothesis, we have developed a set of new scaling relationships, which allow the relaxation time to be computed from the pore size and the permeability to be computed from both the Cole-Cole time constant and the formation factor. Moreover, these new scaling relationships can be also used to predict the dependence of the Cole-Cole time constant as a function of the water saturation under unsaturated conditions. Comparative tests of the proposed new relationships with regard to various published experimental results for saturated clean sands and sandstones as well as for partially saturated clean sandstones, do indeed confirm that the dynamic pore radius L is a much more reliable indicator of the observed relaxation behavior than grain-size-based models.

Field Evaluation of Engineering Fabrics for Asphalt Concrete Resurfacing - Audubon County, HR-360, Construction Report, 1994

An asphalt concrete (ACC) overlay is most often the rehabilitative effort used to maintain the serviceability of either an ACC or PCC pavement. The major problem in durability of this ACC overlay comes from reflective cracking. These cracks usually open, allowing water to enter the unsealed crack and strip the ACC in the overlay. The stripping of the ACC allows accelerated deterioration at the crack. Two engineering fabrics were evaluated in this project in order to determine their effectiveness in reducing reflective cracking. These two materials are: PavePrep, Contech Construction Products, Inc., and Pro-Guard, Phillips Fiber Corporation. A 4.2 km (2.6 mi) roadway in Audubon County was selected for the research project. The roadway was divided into eight test sections. Four of the test sections are conventional resurfacing. The other four sections are split between the two engineering fabrics (two Pro-Guard and two PavePrep). A 75 mm (3 in.) thick overlay was placed over the entire project.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Longitudinal Grinding and Transverse Grooving to Improve Frictional and Profile Properties, HR-1035, 1983

There are many miles of portland cement concrete pavement in Iowa that due to normal wear, and in some cases accelerated wear from studded tires, the surface has become polished resulting in less than desirable friction values. Retexturing the surface may be an economical way to re-establish desirable friction values. Retexturing by grinding with diamond blades and transverse grooving with diamond blades are two methods of rehabilitating p.c.c. surfaces. MU Inc. of Lebanan, Tennessee proposed to provide without charge to the Iowa Department of Transportation, one 1500 ft x 12 ft section each of three methods of texturing. They are longitudinal grinding, transverse grooving and longitudinal grinding followed by transverse grooving. A section of 1500 feet is needed to properly evaluate a texturing method. It was decided by Iowa DOT personnel that due to possible differential friction it would be undesirable to texture only one lane. The decision was made to do test sections of 1500 ft x 24 ft with the cost of the additional texturing paid by the Iowa DOT. Iowa also has areas where the p.c.c. pavement has faulted at the joints and cracks which results in poor riding quality. Methods of correcting the faulting are to underseal the pavement where needed and/or grinding the surface to eliminate the faulted areas. It was decided to include in this research project a section for profiling by grinding.

Asbestos Fibers in Type B Asphaltic Concrete Surface Course, MLR-67-1, 1968

The Standard Specifications for this project included requirements for placing two 500 foot test sections of Type B asphaltic concrete with 1-1/2 per cent asbestos fibres (mix size 3/8 inch, lift thickness 3/4 inch) as part of the regular construction of the surface course. These requirements were designed to provide asbestos modified mixtures for laboratory analysis and road performance evaluation. This report provides the preliminary results and analysis of test data obtained from tests on the mixtures placed on the roadway. Previous research by G. S. Zuelke (1) and J. H. Kestzman et al (2) indicated that asphaltic concrete mixtures modified with asbestos fibres improved stability, decreased permeability, and allowed the use of higher bitumen contents. This study indicated that the addition of asbestos fibres would permit the use of higher bitumen contents, theoretically improving durability, without adverse results. An indication was also obtained to the effect that asbestos mixtures were more difficult to compact in the field.

Low Permeability of Concrete for Bridge Deck Overlay, MLR-89-1, 1993

The penetration of chloride ions from deicing salts into the portland cement concrete of bridge decks can cause corrosion and serious damage to the reinforcing steel. Concrete properties which prevent chloride penetration into the bridge deck and provide a good structural and economic wearing surface are desirable. A variety of mix designs have been tried in the past in search of improved performance and lower costs for bridge deck overlay concrete. A group of mixes with various designs have been tested in this project and results are being compared to determine which concrete mix appears to be the most cost effective and resistant to chloride penetration for bridge deck overlay use.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

The integrin antagonist cilengitide activates alphaVbeta3, disrupts VE-cadherin localization at cell junctions and enhances permeability in endothelial cells.

Cilengitide is a high-affinity cyclic pentapeptdic alphaV integrin antagonist previously reported to suppress angiogenesis by inducing anoikis of endothelial cells adhering through alphaVbeta3/alphaVbeta5 integrins. Angiogenic endothelial cells express multiple integrins, in particular those of the beta1 family, and little is known on the effect of cilengitide on endothelial cells expressing alphaVbeta3 but adhering through beta1 integrins. Through morphological, biochemical, pharmacological and functional approaches we investigated the effect of cilengitide on alphaVbeta3-expressing human umbilical vein endothelial cells (HUVEC) cultured on the beta1 ligands fibronectin and collagen I. We show that cilengitide activated cell surface alphaVbeta3, stimulated phosphorylation of FAK (Y(397) and Y(576/577)), Src (S(418)) and VE-cadherin (Y(658) and Y(731)), redistributed alphaVbeta3 at the cell periphery, caused disappearance of VE-cadherin from cellular junctions, increased the permeability of HUVEC monolayers and detached HUVEC adhering on low-density beta1 integrin ligands. Pharmacological inhibition of Src kinase activity fully prevented cilengitide-induced phosphorylation of Src, FAK and VE-cadherin, and redistribution of alphaVbeta3 and VE-cadherin and partially prevented increased permeability, but did not prevent HUVEC detachment from low-density matrices. Taken together, these observations reveal a previously unreported effect of cilengitide on endothelial cells namely its ability to elicit signaling events disrupting VE-cadherin localization at cellular contacts and to increase endothelial monolayer permeability. These effects are potentially relevant to the clinical use of cilengitide as anticancer agent.

Effects of prior repeated-sprints with different recovery duration on oxygen uptake kinetics during subsequent heavy-exercise.

Introduction: Prior repeated-sprints (6) has become an interesting method to resolve the debate surrounding the principal factors that limits the oxygen uptake (V'O2) kinetics at the onset of exercise [i.e., muscle O2 delivery (5) or metabolic inertia (3)]. The aim of this study was to compare the effects of two repeated-sprints sets of 6x6s separated by different recovery duration between the sprints on V'O2 and muscular de-oxygenation [HHb] kinetics during a subsequent heavy-intensity exercise. Methods: 10 male subjects performed a 6-min constant-load cycling test (T50) at intensity corresponding to half of the difference between V'O2max and the ventilatory threshold. Then, they performed two repeated-sprints sets of 6x6s all-out separated by different recovery duration between the sprints (S1:30s and S2:3min) followed, after 7-min-recovery, by the T50 (S1T50 and S2T50, respectively). V'O2, [HHb] of the vastus lateralis (VL) and surface electromyography activity [i.e., root-mean-square (RMS) and the median frequency of the power density spectrum (MDF)] from VL and vastus medialis (VM) were recorded throughout T50. Models using a bi-exponential function for the overall T50 and a mono-exponential for the first 90s of T50 were used to define V'O2 and [HHb] kinetics respectively. Results: V'O2 mean value was higher in S1 (2.9±0.3l.min-1) than in S2 (1.2±0.3l.min-1); (p<0.001). The peripheral blood flow was increased after sprints as attested by a higher basal heart rate (HRbaseline) (S1T50: +22%; S2T50: +17%; p≤0.008). Time delay [HHb] was shorter for S1T50 and S2T50 than for T50 (-22% for both; p≤0.007) whereas the mean response time of V'O2 was accelerated only after S1 (S1T50: 32.3±2.5s; S2T50: 34.4±2.6s; T50: 35.7±5.4s; p=0.031). There were no significant differences in RMS between the three conditions (p>0.05). MDF of VM was higher during the first 3-min in S1T50 than in T50 (+6%; p≤0.05). Conclusion: The study show that V'O2 kinetics was speeded by prior repeated-sprints with a short (30s) but not a long (3min) inter-sprints-recovery even though the [HHb] kinetics was accelerated and the peripheral blood flow was enhanced after both sprints. S1, inducing a greater PCr depletion (1) and change in the pattern of the fibres recruitment (increase in MDF) compared with S2, may decrease metabolic inertia (2), stimulate the oxidative phosphorylation activation (4) and accelerate V'O2 kinetics at the beginning of the subsequent high-intensity exercise.

Feasibility and efficacy of accelerated weekly concomitant boost postoperative radiation therapy combined with concomitant chemotherapy in patients with locally advanced head and neck cancer.

BACKGROUND: The aim of this study was to assess feasibility and efficacy of weekly concomitant boost accelerated postoperative radiation therapy (PORT) with concomitant chemotherapy (CT) in patients with locally advanced head and neck cancer (LAHNC). METHODS AND MATERIALS: Conformal or intensity-modulated 66-Gy RT was performed in 5.5 weeks in 40 patients. Cisplatin was given at days 1, 22, and 43. Median follow-up was 36 months. RESULTS AND DISCUSSION: Grade 3 mucositis, dysphagia, and erythema was observed in ten (25%), nine (23%), and six (13%) patients, respectively. Grade 3 or more anemia was observed in two (6%) patients, and leukopenia in five (13%) patients. No grade 3 or 4 thrombocytopenia was observed. Grade 3 nephrotoxicity was observed in one patient (3%). No treatment-related mortality was observed. Grade 2 or more xerostomia and edema were observed in ten (25%) and one (3%) patient, respectively. Locoregional relapse occurred in eight patients, and seven patients developed distant metastases. Median time to locoregional relapse was 6 months. Three-year overall, disease-free survival, and locoregional control rates were 63%, 62%, and 81%, respectively. Multivariate analysis revealed that the only prognostic factor was nodal status. CONCLUSION: Reducing overall treatment time using accelerated PORT/CT by weekly concomitant boost (six fractions per week) combined with concomitant cisplatin CT is easily feasible with acceptable morbidity.

Development of a Durability Test for Asphalts, May 1972

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.

Effects of alternative sets of climatic predictors on species distribution models and associated estimates of extinction risk: a test with plants in an arid environment

Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.