Modeling the structure of amorphous MoS3: a neutron diffraction and reverse Monte Carlo study

A model for the structure of amorphous molybdenum trisulfide, a-MoS3, has been created using reverse Monte Carlo methods. This model, which consists of chains Of MoS6 units sharing three sulfurs with each of its two neighbors and forming alternate long, nonbonded, and short, bonded, Mo-Mo separations, is a good fit to the neutron diffraction data and is chemically and physically realistic. The paper identifies the limitations of previous models based on Mo-3 triangular clusters in accounting for the available experimental data.

Self-assembly of two-component gels: stoichiometric control and component selection

Two-component systems capable of self-assembling into soft gel-phase materials are of considerable interest due to their tunability and versatility. This paper investigates two-component gels based on a combination of a L-lysine-based dendron and a rigid diamine spacer (1,4-diaminobenzene or 1,4-diaminocyclohexane). The networked gelator was investigated using thermal measurements, circular dichroism, NMR spectroscopy and small angle neutron scattering (SANS) giving insight into the macroscopic properties, nanostructure and molecular-scale organisation. Surprisingly, all of these techniques confirmed that irrespective of the molar ratio of the components employed, the "solid-like" gel network always consisted of a 1:1 mixture of dendron/diamine. Additionally, the gel network was able to tolerate a significant excess of diamine in the "liquid-like" phase before being disrupted. In the light of this observation, we investigated the ability of the gel network structure to evolve from mixtures of different aromatic diamines present in excess. We found that these two-component gels assembled in a component-selective manner, with the dendron preferentially recognising 1,4-diaminobenzene (>70%). when similar competitor diamines (1,2- and 1,3-diaminobenzene) are present. Furthermore, NMR relaxation measurements demonstrated that the gel based oil 1,4-diaminobenzene was better able to form a selective ternary complex with pyrene than the gel based oil 1,4-diaminocyclohexane, indicative of controlled and selective pi-pi interactions within a three-component assembly. As such, the results ill this paper demonstrate how component selection processes in two-component gel systems call control hierarchical self-assembly.

Hydrogen spillover on carbon-supported metal catalysts studied by inelastic neutron scattering. Surface vibrational states and hydrogen riding modes

Hydrogen spillover on carbon-supported precious metal catalysts has been investigated with inelastic neutron scattering (INS) spectroscopy. The aim, which was fully realized, was to identify spillover hydrogen on the carbon support. The inelastic neutron scattering spectra of Pt/C, Ru/C, and PtRu/C fuel cell catalysts dosed with hydrogen were determined in two sets of experiments: with the catalyst in the neutron beam and, using an annular cell, with carbon in the beam and catalyst pellets at the edge of the cell excluded from the beam. The vibrational modes observed in the INS spectra were assigned with reference to the INS of a polycyclic aromatic hydrocarbon, coronene, taken as a molecular model of a graphite layer, and with the aid of computational modeling. Two forms of spillover hydrogen were identified: H at edge sites of a graphite layer (formed after ambient dissociative chemisorption of H-2), and a weakly bound layer of mobile H atoms (formed by surface diffusion of H atoms after dissociative chernisorption of H-2 at 500 K). The INS spectra exhibited characteristic riding modes of H on carbon and on Pt or Ru. In these riding modes H atoms move in phase with vibrations of the carbon and metal lattices. The lattice modes are amplified by neutron scattering from the H atoms attached to lattice atoms. Uptake of hydrogen, and spillover, was greater for the Ru containing catalysts than for the Pt/C catalyst. The INS experiments have thus directly demonstrated H spillover to the carbon support of these metal catalysts.

Hydrogen adsorption in a copper ZSM5 zeolite: an inelastic neutron scattering study

Currently microporous oxidic materials including zeolites are attracting interest as potential hydrogen storage materials. Understanding how molecular hydrogen interacts with these materials is important in the rational development of hydrogen storage materials and is also challenging theoretically. In this paper, we present an incoherent inelastic neutron scattering (INS) study of the adsorption of molecular hydrogen and hydrogen deuteride (HD) in a copper substituted ZSM5 zeolite varying the hydrogen dosage and temperature. We have demonstrated how inelastic neutron scattering can help us understand the interaction of H-2 molecules with a binding site in a particular microporous material, Cu ZSM5, and by implication of other similar materials. The H-2 molecule is bound as a single species lying parallel with the surface. As H-2 dosing increases, lateral interactions between the adsorbed H-2 molecules become apparent. With rising temperature of measurement up to 70 K (the limit of our experiments), H-2 molecules remain bound to the surface equivalent to a liquid or solid H-2 phase. The implication is that hydrogen is bound rather strongly in Cu ZSM5. Using the simple model for the anisotropic interaction to calculate the energy levels splitting, we found that the measured rotational constant of the hydrogen molecule is reduced as a consequence of adsorption by the Cu ZSM5. From the decrease in total signal intensity with increasing temperature, we were able to observe the conversion of para-hydrogen into ortho-hydrogen at paramagnetic centres and so determine the fraction of paramagnetic sites occupied by hydrogen molecules, ca. 60%. (c) 2006 Elsevier B.V. All rights reserved.

Dihydrogen in zeolite CaX: an inelastic neutron scattering study

We report an inelastic neutron scattering (INS) study of the rotational–vibrational spectrum of dihydrogen sorbed by zeolite CaX. In the low energy (<200 cm−1) INS spectrum of adsorbed H2 we observe the rotational–vibrational spectrum of H2, where the vibration is that of the H2 molecule against the binding site (i.e. H2–X, not H–H). We have observed for the first time the vibrational overtones of the hydrogen molecule against the adsorption surface up to sixth order. These vibrations are usually forbidden in INS spectroscopy because of the selection rules imposed by the spin flip event required. In our case we are able to observe such a vibration because the rotational transition J(1 ← 0) convolutes the vibrational spectrum. This paper reports the effect for the first time.

The effect of vessel diameter on time dependent gas hold-up variations in highly viscous impeller agitated liquids

Time dependent gas hold-up generated in the 0.3 and 0.6 m diameter vessels using high viscosity castor oil and carboxy methyl cellulose (CMC) solution was compared on the basis of impeller speed (N) and gas velocity (V-G). Two types of hold-up were distinguished-the hold-up due to tiny bubbles (epsilon(ft)) and total hold-up (epsilon(f)), which included large and tiny bubbles. It was noted that vessel diameter (i.e. the scale of operation) significantly influences (i) the trends and the values of epsilon(f) and epsilon(ft), and (ii) the values of tau (a constant reflecting the time dependency of hold-up). The results showed that a scale independent correlation for gas hold-up of the form epsilon(f) or epsilon(ft) = A(N or P-G/V)(a) (V-G)(b), where "a" and "b" are positive constants is not appropriate for viscous liquids. This warrants further investigations into the effect of vessel diameter on gas hold-up in impeller agitated high viscosity liquids (mu or mu(a) > 0.4 Pa s). (C) 2003 Elsevier B.V. All rights reserved.

A pilot randomised, open, uncontrolled, clinical study of two dosages of St John's wort (Hypericum perforatum) herb extract (LI-160) as an aid to motivational/behavioural support in smoking cessation

There is an association between smoking and depression, yet the herbal antidepressant St John's wort (Hypericum perforatum L.: SJW) herb extract has not previously been investigated as an aid in smoking cessation. In this open, uncontrolled, pilot study, 28 smokers of 10 or more cigarettes per day for at least one year were randomised to receive SJW herb extract (LI-160) 300mg once or twice daily taken for one week before and continued for 3 months after a target quit date. In addition, all participants received motivational/behavioural support from a trained pharmacist. At 3 months, the point prevalence and continuous abstinence rates were both 18%, and at 12 months were 0%. Fifteen participants (54%) reported 23 adverse events up to the end of the 3-month follow-up period. There was no statistically significant difference in the frequency of adverse events for participants taking SJW once or twice daily (p > 0.05). Most adverse events were mild, transient and non-serious. This preliminary study has not provided convincing evidence that a SJW herb extract plus individual motivational/behavioural support is likely to be effective as an aid in smoking cessation. However, it may be premature to rule out a possible effect on the basis of a single, uncontrolled pilot study, and other approaches involving SJW extract may warrant investigation.

Largest connected component of a star graph with faulty vertices

In order to make a full evaluation of an interconnection network, it is essential to estimate the minimum size of a largest connected component of this network provided the faulty vertices in the network may break its connectedness. Star graphs are recognized as promising candidates for interconnection networks. This article addresses the size of a largest connected component of a faulty star graph. We prove that, in an n-star graph (n >= 3) with up to 2n-4 faulty vertices, all fault-free vertices but at most two form a connected component. Moreover, all fault-free vertices but exactly two form a connected component if and only if the set of all faulty vertices is equal to the neighbourhood of a pair of fault-free adjacent vertices. These results show that star graphs exhibit excellent fault-tolerant abilities in the sense that there exists a large functional network in a faulty star graph.

Approximate Riemann solutions of the two-dimensional shallow-water equations

A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.

An efficient numerical scheme for the two-dimensional shallow water equations using arithmetic averaging

A finite difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gas dynamics is defined, and a scheme, based on numerical characteristic decomposition is presented for obtaining approximate solutions to the linearised problem, and incorporates the technique of operator splitting. An average of the flow variables across the interface between cells is required, and this average is chosen to be the arithmetic mean for computational efficiency leading to arithmetic averaging. This is in contrast to usual ‘square root’ averages found in this type of Riemann solver, where the computational expense can be prohibitive. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids nonphysical, spurious oscillations. An extension to the two-dimensional equations with source terms is included. The scheme is applied to the one-dimensional problems of a breaking dam and reflection of a bore, and in each case the approximate solution is compared to the exact solution of ideal fluid flow. The scheme is also applied to a problem of stationary bore generation in a channel of variable cross-section. Finally, the scheme is applied to two other dam-break problems, this time in two dimensions with one having cylindrical symmetry. Each approximate solution compares well with those given by other authors.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Comparison of bottom-up protein identification methods

With the rapid development of proteomics, a number of different methods appeared for the basic task of protein identification. We made a simple comparison between a common liquid chromatography-tandem mass spectrometry (LC-MS/MS) workflow using an ion trap mass spectrometer and a combined LC-MS and LC-MS/MS method using Fourier transform ion cyclotron resonance (FTICR) mass spectrometry and accurate peptide masses. To compare the two methods for protein identification, we grew and extracted proteins from E. coli using established protocols. Cystines were reduced and alkylated, and proteins digested by trypsin. The resulting peptide mixtures were separated by reversed-phase liquid chromatography using a 4 h gradient from 0 to 50% acetonitrile over a C18 reversed-phase column. The LC separation was coupled on-line to either a Bruker Esquire HCT ion trap or a Bruker 7 tesla APEX-Qe Qh-FTICR hybrid mass spectrometer. Data-dependent Qh-FTICR-MS/MS spectra were acquired using the quadrupole mass filter and collisionally induced dissociation into the external hexapole trap. Proteins were in both schemes identified by Mascot MS/MS ion searches and the peptides identified from these proteins in the FTICR MS/MS data were used for automatic internal calibration of the FTICR-MS data, together with ambient polydimethylcyclosiloxane ions.

Relationship between phonons and thermal expansion in Zn(CN)2 and Ni(CN)2 from inelastic neutron scattering and ab initio calculations

Zn(CN)2 and Ni(CN)2 are known for exhibiting anomalous thermal expansion over a wide temperature range. The volume thermal expansion coefficient for the cubic, three dimensionally connected material, Zn(CN)2, is negative (alpha(V) = −51  10(-6) K-1) while for Ni(CN)2, a tetragonal material, the thermal expansion coefficient is negative in the two dimensionally connected sheets (alpha(a) = −7  10(-6) K-1), but the overall thermal expansion coefficient is positive (alpha(V) = 48  10(-6) K-1). We have measured the temperature dependence of phonon spectra in these compounds and analyzed them using ab initio calculations. The spectra of the two compounds show large differences that cannot be explained by simple mass renormalization of the modes involving Zn (65.38 amu) and Ni (58.69 amu) atoms. This reflects the fact that the structure and bonding are quite different in the two compounds. The calculated pressure dependence of the phonon modes and of the thermal expansion coefficient, alpha(V), are used to understand the anomalous behavior in these compounds. Our ab initio calculations indicate that phonon modes of energy approx. 2 meV are major contributors to negative thermal expansion (NTE) in both the compounds. The low-energy modes of approx.8 and 13 meV in Zn(CN)2 also contribute significantly to the NTE in Zn(CN)2 and Ni(CN)2, respectively. The measured temperature dependence of the phonon spectra has been used to estimate the total anharmonicity of both compounds. For Zn(CN)2, the temperature-dependent measurements (total anharmonicity), along with our previously reported pressure dependence of the phonon spectra (quasiharmonic), is used to separate the explicit temperature effect at constant volume (intrinsic anharmonicity).

The effect of the year of wheat variety release on productivity and stability of performance on two organic and two non-organic farms

Nineteen wheat cultivars, released from 1934 to 2000, were grown at two organic and two non-organic sites in each of 3 years. Assessments included grain yield, grain protein concentration, protein yield, disease incidence and green leaf area. The superiority of each cultivar (the sum of the squares of the differences between its mean in each environment and the mean of the best cultivar there, divided by twice the number of environments; CS) was calculated for yield, grain protein concentration and protein yield, and ranked in each environment. The yield and grain protein concentration CS were more closely correlated with cultivar release date at the non-organic sites than at organic sites. This difference may be attributed to higher yield levels with larger differences among cultivars at the non-organic sites, rather than to improved stability (i.e. similar ranks) across sites. The significant difference in the correlation of protein yield CS and cultivar age between organic and non-organic sites would support evidence that the ability to take up mineral nitrogen (N) compared to soil N has been a component of the selection conditions of more modern cultivars (released after 1989). This is supported by assessment of green leaf area (GLA), where more modern cultivars in the non-organic systems had greater late-season GLA, a trend that was not identified in organic conditions. This effect could explain the poor correlation between age and protein yield CS in organic compared to non-organic conditions where modern cultivars are selected to benefit from later nitrogen (N) availability which includes the spring nitrogen applications tailored to coincide with peak crop demand. Under organic management, N release is largely based on the breakdown of fertility-building crops incorporated (ploughed-in) in the previous autumn. The release of nutrients from these residues is dependent on the soil conditions, which includes temperature and microbial populations, in addition to the potential leaching effect of high winter rainfall in the UK. In organic cereal crops, early resource capture is a major advantage for maximizing the utilization of nutrients from residue breakdown. It is concluded that selection of cultivars under conditions of high agrochemical inputs selects for cultivars that yield well under maximal conditions in terms of nutrient availability and pest, disease and weed control. The selection conditions for breeding have a tendency to select cultivars which perform relatively better in non-organic compared to organic systems.

The power of NMR.: in two and three dimensions

Soon after its discovery in the 1950s, NMR had become an indispensable tool fr chemists. In the 1970s and 1980s, the power of the technique was extended from one dimension to two and even three dimensions, opening up exciting applkications in both chemistry and biochemistry. the success of one dimensional. high-resolution NMR stems from the unique insights that it can provide about molecular structure. The chemical shift of a nucleus gives invaluable information abut the chemical environment in which that nucleus is located, Coupling interactions between hydorgen nuclei, as revealed by characteristic splitting patterns inthe 1H-NMR spectrum, provide informaton about the loaction of one group of hydorgen atoms relative to others inthe molecule. And the nuclearf Overhauser effect (nOe) can shed light on molecular stereochemistry.