967 resultados para Postural instability


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Study Design: Fine-wire EMG rotator cuff onset time analysis in 2 matched groups of throwers with and without pain. Objective: To identify if there is a difference in the activation patterns of the rotator cuff muscles during a rapid shoulder external rotation task between throwers with and without pain. Background: The coordinated action of the rotator cuff is recognized as essential for glenohumeral joint control in the throwing athlete. Identification of abnormalities occurring in muscle activation patterns for injured athletes is relevant when prescribing rehabilitative exercises. Methods and Measures: Twelve throwers with shoulder pain were compared to a matched group of 11 asymptomatic throwers. Participants were matched for age, height, body mass, and habitual activity. Fine-wire EMG electrodes were inserted into the subscapularis, supraspinatus, and infraspinatus. EMG activity was measured during a reaction time task of rapid shoulder external rotation in a seated position. The timing of onset of EMG activity was analyzed in relation to visualization of a light (reaction time) and to the onset of infraspinatus activity (relative latency). Results: In the group with shoulder pain, the onset of subscapularis activity was found to be significantly delayed (reaction time, P = .0018; relative latency, P = .0005) from the onset of infraspinatus activity when compared to the control group. Conclusions: The presence of shoulder pain in these athletes was associated with a difference in the onset of subscapularis EMG activity during a rapid shoulder external rotation movement. This was an initial step in the understanding of the joint protection mechanisms of the glenohumeral joint and the problems that occur in throwers. This information may assist in providing future guidelines for more effective rehabilitation and prevention strategies for this condition.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Hepatocellular carcinoma (HCC) is associated with multiple risk factors and is believed to arise from pre-neoplastic lesions, usually in the background of cirrhosis. However, the genetic and epigenetic events of hepatocarcinogenesis are relatively poorly understood. HCC display gross genomic alterations, including chromosomal instability (CIN), CpG island methylation, DNA rearrangements associated with hepatitis B virus (HBV) DNA integration, DNA hypomethylation and, to a lesser degree, microsatellite instability. Various studies have reported CIN at chromosomal regions, 1p, 4q, 5q, 6q, 8p, 10q, 11p, 16p, 16q, 17p and 22q. Frequent promoter hypermethylation and subsequent loss of protein expression has also been demonstrated in HCC at tumor suppressor gene (TSG), p16, p14, p15, SOCS1, RIZ1, E-cadherin and 14-3-3 sigma. An interesting observation emerging from these studies is the presence of a methylator phenotype in hepatocarcinogenesis, although it does not seem advantageous to have high levels of microsatellite instability. Methylation also appears to be an early event, suggesting that this may precede cirrhosis. However, these genes have been studied in isolation and global studies of methylator phenotype are required to assess the significance of epigenetic silencing in hepatocarcinogenesis. Based on previous data there are obvious fundamental differences in the mechanisms of hepatic carcinogenesis, with at least two distinct mechanisms of malignant transformation in the liver, related to CIN and CpG island methylation. The reason for these differences and the relative importance of these mechanisms are not clear but likely relate to the etiopathogenesis of HCC. Defining these broad mechanisms is a necessary prelude to determine the timing of events in malignant transformation of the liver and to investigate the role of known risk factors for HCC.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Numerical methods are used to simulate the double-diffusion driven convective pore-fluid flow and rock alteration in three-dimensional fluid-saturated geological fault zones. The double diffusion is caused by a combination of both the positive upward temperature gradient and the positive downward salinity concentration gradient within a three-dimensional fluid-saturated geological fault zone, which is assumed to be more permeable than its surrounding rocks. In order to ensure the physical meaningfulness of the obtained numerical solutions, the numerical method used in this study is validated by a benchmark problem, for which the analytical solution to the critical Rayleigh number of the system is available. The theoretical value of the critical Rayleigh number of a three-dimensional fluid-saturated geological fault zone system can be used to judge whether or not the double-diffusion driven convective pore-fluid flow can take place within the system. After the possibility of triggering the double-diffusion driven convective pore-fluid flow is theoretically validated for the numerical model of a three-dimensional fluid-saturated geological fault zone system, the corresponding numerical solutions for the convective flow and temperature are directly coupled with a geochemical system. Through the numerical simulation of the coupled system between the convective fluid flow, heat transfer, mass transport and chemical reactions, we have investigated the effect of the double-diffusion driven convective pore-fluid flow on the rock alteration, which is the direct consequence of mineral redistribution due to its dissolution, transportation and precipitation, within the three-dimensional fluid-saturated geological fault zone system. (c) 2005 Elsevier B.V. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Study Design. A clinical study was conducted on 39 patients with acute, first-episode, unilateral low back pain and unilateral, segmental inhibition of the multifidus muscle. Patients were allocated randomly to a control or treatment group. Objectives. To document the natural course of lumbar multifidus recovery and to evaluate the effectiveness of specific, localized, exercise therapy on muscle recovery. Summary of Background Data. Acute low back pain usually resolves spontaneously, but the recurrence rate is high. Inhibition of multifidus occurs with acute, first-episode, low back pain, and pathologic changes in this muscle have been linked with poor outcome and recurrence of symptoms. Methods. Patients in group 1 received medical treatment only. Patients in group 2 received medical treatment and specific, localized, exercise therapy. Outcome measures for both groups included 4 weekly assessments of pain, disability, range of motion, and size of the multifidus cross-sectional area. Independent examiners were blinded to group allocation. Patients were reassessed at a 10-week follow-up examination. Results. Multifidus muscle recovery was not spontaneous on remission of painful symptoms in patients in group 1. Muscle recovery was more rapid and more complete in patients in group 2 who received exercise therapy (P = 0.0001). Other outcome measurements were similar for the two groups at the 4-week examination. Although they resumed normal levels of activity, patients in group 1 still had decreased multifidus muscle size at the 10-week follow-up examination. Conclusions. Multifidus muscle recovery is not spontaneous on remission of painful symptoms. Lack of localized, muscle support may be one reason for the high recurrence rate of low back pain following the initial episode.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background and objectives: Cardiac positioning and stabilization during myocardial revascularization without extracorporeal circulation (ECC) may cause hemodynamic changes dependent to the surgical site. The objective of this study was to evaluate these changes during distal coronary anastomosis. Methods: Twenty adult patients undergoing myocardial revascularization without ECC were monitored by pulmonary artery catheter and transesophageal Echo Doppler. Hemodynamic data were collected at the following times before removing the stabilizer wall: (1) after volume adjustments, (2) at the beginning of distal anastomosis, and (3) after 5 minutes. Treated coronary arteries were grouped according to their location in the lateral, anterior, or posterior wall. Two-way ANOVA with repetition and Newman-Keuls post-test were used in the analysis. A p value < 0.05 was considered statically significant. Results: During myocardial revascularization without ECC, pulmonary artery wedge pressure showed elevation from 17.7 +/- 6.1 to 19.2 +/- 6.5 (p < 0.001) and 19.4 +/- 5.9 mmHg (p < 0.001), while the central venous pressure went from 13.9 +/- 5.4 to 14.9 +/- 5.9 mmHg (p = 0.007) and 15.1 +/- 6.0 mmHg (p = 0.006). Intermittent cardiac output was reduced from 4.70 +/- 1.43 to 4.23 +/- 1.22 (p < 0.001) and 4.26 +/- 1.25 L.min(-1) (p < 0.001). According to transesophageal Doppler, a significant group-time interaction was observed in cardiac output, which was reduced in the lateral group from 4.08 +/- 1.99 to 2.84 +/- 1.82 (p = 0.02) and 2.86 +/- 1.73 L.min(-1) (p = 0.02), and aortic blood flow, which went from 2.85 +/- 1.39 to 1.99 +/- 1.26 (p = 0.02) and 2.00 +/- 1.21 L.min(-1) (p = 0.02). Other hemodynamic changes were not observed during anastomoses. Conclusions: A significant hemodynamic deterioration was observed during myocardial revascularization without ECC. Transesophageal Doppler detected a decrease in cardiac output only in the lateral group.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Little consensus exists in the literature regarding methods for determination of the onset of electromyographic (EMG) activity. The aim of this study was to compare the relative accuracy of a range of computer-based techniques with respect to EMG onset determined visually by an experienced examiner. Twenty-seven methods were compared which varied in terms of EMG processing (low pass filtering at 10, 50 and 500 Hz), threshold value (1, 2 and 3 SD beyond mean of baseline activity) and the number of samples for which the mean must exceed the defined threshold (20, 50 and 100 ms). Three hundred randomly selected trials of a postural task were evaluated using each technique. The visual determination of EMG onset was found to be highly repeatable between days. Linear regression equations were calculated for the values selected by each computer method which indicated that the onset values selected by the majority of the parameter combinations deviated significantly from the visually derived onset values. Several methods accurately selected the time of onset of EMG activity and are recommended for future use. Copyright (C) 1996 Elsevier Science Ireland Ltd.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Introduction: The relevance of prostate size in the pathophysiology of lower urinary tract symptoms (LUTS) is controversial. We evaluated the urodynamic findings in patients with LUTS and small prostate volumes. Materials and Methods: 84 patients aged >= 50 years with LUTS and prostates < 40 ml were evaluated. All had an International Prostate Symptom Score (IPSS) >= 8. Average age was 62.0 +/- 8.1 years. We evaluated the impact of bladder outlet obstruction (BOO) and detrusor overactivity (DO) on the voiding symptoms and urodynamic findings. Results: Mean prostate volume was 29.2 +/- 7.2 ml and mean IPSS was 13.5 +/- 4.6. BOO was the main finding, affecting 42 (50.0%) patients, followed by detrusor underactivity (DU) in 41 (48.8%) and DO in 28 (33.3%) patients. Patients without BOO were significantly older than the obstructed (64.0 +/- 8.8 and 60.1 +/- 6.9 years, respectively; p = 0.026) and had an increased prevalence of DU (76.2 and 21.4%, respectively; p < 0.001). Comparison of patients with and without DO showed reduced bladder capacity and compliance in the DO group (p < 0.001). No other comparisons were significant. Conclusion: Half of the patients with LUTS and small prostates are not obstructed and may have DO or decreased detrusor contractility as the basis for their voiding symptoms. Our results emphasize the value of urodynamics in this population, especially when invasive treatments are being considered. Copyright (c) 2008 S. Karger AG, Basel.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Aims: To report the conclusion of the Think Thank 8 on Compliance Discussions during the second ICI-RS meeting in 2010. Methods: During a 3-day meeting a group of specialists discussed bladder compliance, what it represents, how it can be measured and if it is clinically relevant. Results: Bladder compliance is the result of a mathematical calculation of the volume required for a unit rise of pressure measured during a cystometric filling. It gives an indication on how the different mechanisms in the bladder wall react on stretching. There is a need of standardization of measurement and suggestions for this are given in the text. Pitfalls are described and how to avoid them. There is a wide range of compliance values in healthy volunteers and groups of patients. Poor compliance needs to be defined better as it can have significant clinical consequences. Prevention and treatment are discussed. Conclusion: If compliance is correctly measured and interpreted, it has importance in urodynamic testing and gives information relevant for clinical management. Neurourol. Urodynam. 30:714-722, 2011. (C) 2011 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background and Purpose. Activity of the trunk muscles is essential for maintaining stability of the lumbar spine because of the unstable structure of that portion of the spine. A model involving evaluation of the response of the lumbar multifidus and abdominal muscles to leg movement was developed to evaluate this function. Subjects. To examine this function in healthy persons, 9 male and 6 female subjects (mean age = 20.6 years, SD = 2.3) with no history of low back pain were studied. Methods. Fine-wire and surface electromyography electrodes were used to record the activity of selected trunk muscles and the prime movers for hip flexion, abduction, and extension during hip movements in each of these directions. Results. Trunk muscle activity occurring prior to activity of the prime mover of the limb was associated with hip movement in each direction. The transversus abdominis (TrA) muscle was invariably the first muscle that was active. Although reaction time for the TrA and oblique abdominal muscles was consistent across movement directions, reaction time for the rectus abdominis and multifidus muscles varied with the direction of limb movement. Conclusion and Discussion. Results suggest that the central nervous st stem deals with stabilization of the spine by contraction of the abdominal and multifidus muscles in anticipation of reactive forces produced by limb movement. The TrA and oblique abdominal muscles appear to contribute to a function not related to the direction of these forces.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Magneto-transport measurements of the 2D hole system (2DHS) in p-type Si-Si1-xGex heterostructures identify the integer quantum Hall effect (IQHE) at dominantly odd-integer filling factors v and two low-temperature insulating phases (IPs) at v = 1.5 and v less than or similar to 0.5, with re-entrance to the quantum Hall effect at v = 1. The temperature dependence, current-voltage characteristics, and tilted field and illumination responses of the IP at v = 1.5 indicate that the important physics is associated with an energy degeneracy of adjacent Landau levels of opposite spin, which provides a basis for consideration of an intrinsic, many-body origin.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Because the structure of the spine is inherently unstable, muscle activation is essential for the maintenance of trunk posture and intervertebral control when the limbs are moved. To investigate how the central nervous system deals with this situation the temporal components of the response of the muscles of the trunk were evaluated during rapid limb movement performed in response to a visual stimulus. Fine-wire electromyography (EMG) electrodes were inserted into transversus abdominis (TrA), obliquus internus abdominis (OI) and obliquus externus abdominis (OE) of 15 subjects under the guidance of real-time ultrasound imaging. Surface electrodes were placed over rectus abdominis (RA), lumbar multifidus (MF) and the three parts of deltoid. In a standing position, ten repetitions of shoulder flexion, abduction and extension were performed by the subjects as fast as possible in response to a visual stimulus. The onset of TrA EMG occurred in advance of deltoid irrespective of the movement direction. The time to onset of EMC activity of OI, OE, RA and MF varied with the movement direction, being activated earliest when the prime action of the muscle opposed the reactive forces associated with the specific limb movement. It is postulated that the non-direction-specific contraction of TrA may be related to the control of trunk. stability independent of the requirement for direction-specific control of the centre of gravity in relation to the base of support.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A traveling wave of BaSO4 in the chlorite-thiourea reaction has shown concentric precipitation patterns upon being triggered by the autocatalyst HOCl. The precipitation patterns show circular rings of alternate null and full precipitation regions. This self-organization appears to be the result of the formation of a convective torus. The formation of the convective torus can be described as a Benard-Marangoni instability with lateral heating.