981 resultados para Muscular dystrophy


Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study examined the effects of 26 days of oral creatine monohydrate (Cr) supplementation on near-maximal muscular strength, high-intensity bench press performance, and body composition. Eighteen male powerlifters with at least 2 years resistance training experience took part in this 28-day experiment. Pre and postmeasurements (Days 1 and 28) were taken of near-maximal muscular strength, body mass, and % body fat. There were two periods of supplementation Days 2 to 6 and Days 7 to 27. ANOVA and t-tests revealed that Cr supplementation significantly increased body mass and lean body mass with no changes in % body fat. Significant increases in 3-RM strength occurred in both groups, both absolute and relative to body mass; the increases were greater in the Cr group. The change in total repetitions also increased significantly with Cr supplementation both in absolute terms and relative to body mass, while no significant change was seen in the placebo (P) group. Creatine supplementation caused significant changes in the number of BP reps in Sets 1, 4, and 5. No changes occurred in the P group. It appears that 26 days of Cr supplementation significantly improves muscular strength and repeated near-maximal BP performance, and induces changes in body composition.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Evaluation of trunk movements, trunk muscle activation, intra-abdominal pressure and displacement of centres of pressure and mass was undertaken to determine whether trunk orientation is a controlled variable prior to and during rapid bilateral movement of the upper limbs. Standing subjects performed rapid bilateral symmetrical upper limb movements in three directions (flexion, abduction and extension). The results indicated a small (0.4-3.3 degrees) but consistent initial angular displacement between the segments of the trunk in a direction opposite to that produced by the reactive moments resulting from limb movement. Phasic activation of superficial trunk muscles was consistent with this pattern of preparatory motion and with the direction of motion of the centre of mass. In contrast, activation of the deep abdominal muscles was independent of the direction of limb motion, suggesting a non-direction specific contribution to spinal stability. The results support the opinion that feedforward postural responses result in trunk movements, and that orientation of the trunk and centre of mass are both controlled variables in relation to rapid limb movements.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A diagnosis is given for the lecithasterid genus Hysterolecithoides Yamaguti, 1934, which is now found to have two to six (possibly seven) vitelline masses. The species H. frontilatus (Manter, 1969) is returned to the genus, having been considered a member of the bunocotylid genus Neotheletrum by recent authors. It is redescribed from Siganus nebulosus, Moreton Bay, and S. doliatus, Lizard Island, Great Barrier Reef and New Caledonia, with emphasis on the presence of Juel's organ, a uterine seminal receptacle and the blind sac associated with the genital atrium. It differs from its congeners in the trajectory of the pars prostatica which recurves dorsally to the sinus-sac. Oligolecithoides Shen, 1982 is synonymised with Hysterolecithoides and O. trilobatus Shen, 1982 is synomised with H. epinepheli Yamaguti, 1934. Machidatrema Leon-Regagnon, 1998 is diagnosed, and found to be close to Hysterolecithoides, but differs in the lack of a blind-sac projecting from the dorsal genital atrium, by its tandem testes, the coiling of the uterus between the testes and the ovary, and the ventral excretory pore. M. leonae n. sp. is described from Siganus fuscescens, S. lineatus, S. doliatus, S. corallinus, S. vulpinus and Scarus globiceps at Heron Island, Queensland. It differs from its closest congener, M. akeh, in the muscular and tegumental flap over the genital pore and details of the terminal genitalia. M. chilostoma (Machida, 1980) and M. kyphosi (Yamaguti, 1970) are redescribed from Kyphosus vaigiensis from Heron Island. Neotheletrum Gibson & Bray, 1979 is diagnosed: it differs from Hysterolecithoides in its confluent excretory arms, blind seminal receptacle (no Juel's organ) and uniformly tripartite vitellarium. A cladistic analysis suggests that M. chilostoma and M. kyphosi are not best accommodated in Machidatrema, that Machidatrema (sensu stricto) is monophyletic and that Hysterolecithoides is paraphyletic. Hysterolecithoides and Machidatrema are considered hysterolecithine lecithasterids, whilst Neotheletrum is retained as an opisthadenine bunocotylid.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The cloacal complex of Crocodylus porosus is composed of three chambers (proctodaeum, urodaeum, and coprodaeum) separated by tight, muscular sphincters. The proctodaeum is proximal to the cloacal vent and houses the genitalia. The urodaeum is the largest chamber, is capable of storing large quantities of urine, and is lined with an epithelium with the capacity for transepithelial water and ion exchange. The coprodaeum, the most orad cloacal chamber, is a small, only marginally expandable chamber that has an epithelium composed almost entirely of mucus-secreting cells. The coprodaeum and lower intestine are reported to be the site(s) for urine modification in birds and bladderless lizards. A radiographic trace of urine storage in C. porosus kept for 2 months under hyperosmotic conditions showed no signs of retrograde movement of urine into the coprodaeum or rectum. Instead, urine was stored in the urodaeum of C. porosus. Examination of the mucosal surface of the urodaeum by SEM showed a plastic response to environmental salinity, with a possible increase in surface area in animals kept in hyperosmotic water compared with animals from fresh water. We propose the urodaeum as the primary site for postrenal modification of urine in C, porosus. (C) 2000 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Establishment of the left-right axis is a fundamental process of vertebrate embryogenesis. Failure to develop left-right asymmetry leads to incorrect positioning and morphogenesis of numerous internal organs, and is proposed to underlie the etiology of several common cardiac malformations. The transcriptional modulator Cited2 is essential for embryonic development: Cited2-null embryos die during gestation with profound developmental abnormalities, including cardiac malformations, exencephaly and adrenal agenesis. Cited2 is also required for normal establishment of the left-right axis; we demonstrate that abnormal heart looping and right atrial and pulmonary isomerism are consistent features of the left-right-patterning defect. We show by gene expression analysis that Cited2 acts upstream of Nodal, Lefty2 and Pitx2 in the lateral mesoderm, and of Lefty1 in the presumptive floor plate. Although abnormal left-right patterning has a major impact on the cardiac phenotype in Cited2-null embryos, laterality defects are only observed in a proportion of these embryos. We have therefore used a combination of high-resolution imaging and three-dimensional (3D) modeling to systematically document the full spectrum of Cited2-associated cardiac defects. Previous studies have focused on the role of Cited2 in cardiac neural crest cell development, as Cited2 can bind the transcription factor Tfap2, and thus affect the expression of Erbb3 in neural crest cells. However, we have identified Cited2-associated cardiac defects that cannot be explained by laterality or neural crest abnormalities. In particular, muscular ventricular septal defects and reduced cell density in the atrioventricular (AV) endocardial cushions are evident in Cited2-null embryos. As we found that Cited2 expression tightly correlated with these sites, we believe that Cited2 plays a direct role in development of the AV canal and cardiac septa. We therefore propose that, in addition to the previously described reduction of cardiac neural crest cells, two other distinct mechanisms contribute to the spectrum of complex cardiac defects in Cited2-null mice; disruption of normal left-right patterning and direct loss of Cited2 expression in cardiac tissues.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Eccentric exercise commonly results in muscle damage. The primary sequence of events leading to exercise-induced muscle damage is believed to involve initial mechanical disruption of sarcomeres, followed by impaired excitation-contraction coupling and calcium signaling, and finally, activation of calcium-sensitive degradation pathways. Muscle damage is characterized by ultrastructural changes to muscle architecture, increased muscle proteins and enzymes in the bloodstream, loss of muscular strength and range of motion and muscle soreness. The inflammatory response to exercise-induced muscle damage is characterized by leukocyte infiltration and production of pro-inflammatory cytokines within damaged muscle tissue, systemic release of leukocytes and cytokines, in addition to alterations in leukocyte receptor expression and functional activity. Current evidence suggests that inflammatory responses to muscle damage are dependent on the type of eccentric exercise, previous eccentric loading (repeated bouts), age and gender. Circulating neutrophil counts and systemic cytokine responses are greater after eccentric exercise using a large muscle mass (e.g. downhill running, eccentric cycling) than after other types of eccentric exercise involving a smaller muscle mass. After an initial bout of eccentric exercise, circulating leukocyte counts and cell surface receptor expression are attenuated. Leukocyte and cytokine responses to eccentric exercise are impaired in elderly individuals, while cellular infiltration into skeletal muscle is greater in human females than males after eccentric exercise. Whether alterations in intracellular calcium homeostasis influence inflammatory responses to muscle damage is uncertain. Furthermore, the effects of antioxidant supplements are variable, and the limited data available indicates that anti-inflammatory drugs largely have no influence on inflammatory responses to eccentric exercise. In this review, we compare local versus systemic inflammatory responses, and discuss some of the possible mechanisms regulating the inflammatory responses to exercise-induced muscle damage in humans.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Dermatomyositis is an unknown cause`s disease that in general is characterized by muscular inflammation with weakness and typical skin rash (heliotrope and Gottron`s papules). In this article we describe a 13-year-old girl with juvenile dermatomyositis associated with toxoplasmosis. Myositis was treated with corticosteroids and immunosuppressive drugs, but she had good response only after anti-parasitary drug was started.-

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: Retinitis pigmentosa (RP) is a group of genetically heterogeneous diseases with progressive degeneration of the retina. The condition can be inherited as an autosomal dominant, autosomal recessive, and X-linked trait. Methods: We report on two female twin pairs. One twin of each pair is affected with RP, the other twin is unaffected, both clinically and functionally. Molecular analysis in both twins included zygosity determination, arrayed primer extension chip analysis for autosomal recessive and dominant RP, sequencing of the entire RPGR gene, and analysis of X-chromosome inactivation status. Results: Both unrelated twin pairs were genetically identical. Of the potential pathogenetic mechanisms, skewed X-inactivation was excluded on leukocytes. Autosomal recessive RP and autosomal dominant RP arrayed primer extension chip analysis result was completely normal, excluding known mutations in known genes as the cause of disease in the affected twins. Sequencing excluded mutations in RPGR. A postzygotic recessive or dominant genetic mutation of an RP gene is not impossible. A postfertilization error as a potential cause of uniparental isodisomy is unlikely albeit not entirely impossible. Conclusion: The authors report on the second and third unrelated identical twin pair discordant for RP. The exact cause of the condition and the explanation of the clinical discordance remain elusive. RETINA 31:1164-1169, 2011

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Single session repetitive transcranial magnetic stimulation (rTMS) of the motor cortex (M1) is effective in the treatment of chronic pain patients but the analgesic effect of repeated sessions is still unknown We evaluated the effects of rTMS in patients with refractory pain due to complex regional pain syndrome (CRPS) type I Twenty three patients presenting CRPS type I of 1 upper limb were treated with the best medical treatment (analgesics and adjuvant medications physical therapy) plus 10 daily sessions of either real (r) or sham (s) 10Hz rTMS to the motor cortex (M1) Patients were assessed daily and after 1 week and 3 months after the last session using the Visual Analogical Scale (VAS) the McGill Pain Questionnaire (MPQ) the Health Survey 36 (SF 36) and the Hamilton Depression (HDRS) During treatment there was a significant reduction in the VAS scores favoring the r rTMS group mean reduction of 4 65 cm (50 9%) against 2 18 cm (24 7%) in the s rTMS group The highest reduction occurred at the tenth session and correlated to improvement in the affective and emotional subscores of the MPQ and SF 36 Real rTMS to the M1 produced analgesic effects and positive changes in affective aspects of pain in CRPS patients during the period of stimulation Perspective This study shows an efficacy of repetitive sessions of high frequency rTMS as an add on therapy to refractory CAPS type I patients It had a positive effect in different aspects of pain (sensory discriminative and emotional affective) It opens the perspective for the clinical use of this technique (C) 2010 by the American Pain Society

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objective: The aim of this paper is to study the respiratory muscle strength by evaluating the maximal inspiratory pressure (MIP), maximal expiratory pressure (MEP) and lung volume before and 3 and 6 months after adenotonsillectomy. This is an interventional, before and after trial. It was set at the Department of Otolaryngology. University of Sao Paulo, School of Medicine. We included 29 children (6-13 years old), both genders, consecutively recruited from the waiting list for adenotonsillectomy. Children were submitted to maximal inspiratory pressures (MIP), maximal expiratory pressure (MEP) evaluation using an analog manovacuometer, lung volume, using incentive expirotometer and thoracic and abdominal perimeter using a centimeter tape. Children were evaluated in 3 different moments: 1 week before and 3 and 6 months after surgery. Results: MIP improved significantly 3 months (p < 0.001) after adenotonsillectomy and MEP did not change (p = 1). There were increases in lung volume (p = 000), chest (p = 0.017) and abdominal perimeter (p = 0.05). Six months after surgery, all parameters improved. MIP (p = 0), MEP (p = 0), lung volume (p = 0.02), chest (p = 0.034) and abdominal perimeter (p = 0.23). Conclusion: This study suggests that there was an improvement in respiratory muscular strength, once there was a significant improvement in maximal inspiratory pressure, lung volume and other parameters after adenotonsillectomy. (C) 2010 Elsevier Ireland Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: Treatment of excessive gingival display usually involves procedures such as Le Fort impaction or maxillary gingivectomies. The authors propose an alternative technique that reduces the muscular function of the elevator of the upper lip muscle and repositioning of the upper lip. Methods: Fourteen female patients with excessive gingival exposure were operated on between February of 2008 and March of 2009. They were filmed before and at least 6 months after the procedure. They were asked to perform their fullest smile, and the maximum gingival exposures were measured and analyzed using ImageJ software. Patients were operated on under local anesthesia. Their gingival mucosa was freed from the maxilla using a periosteum elevator. Skin and subcutaneous tissue were dissected bluntly from the underlying musculature of the upper lip. A frenuloplasty was performed to lengthen the upper lip. Both levator labii superioris muscles were dissected and divided. Results: The postoperative course was uneventful in all of the patients. The mean gingival exposure before surgery was 5.22 +/- 1.48 mm; 6 months after surgery, it was 1.91 +/- 1.50 mm. The mean gingival exposure reduction was 3.31 +/- 1.05 mm (p < 0.001), ranging from 1.59 to 4.83 mm. Conclusion: This study shows that the proposed technique was efficient in reducing the amount of exposed gum during smile in all patients in this series. (Plast. Reconstr. Surg. 126: 1014, 2010.)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Idiopathic inflammatory myopathies (IIM) are a heterogeneous group of diseases that share some symptoms such as muscular weakness and inflammation of skeletal muscle. Complete recovery of muscle function with pharmacological treatment does not always occur, suggesting that physical inability is a great concern for these patients. In this context, it has been speculated that physical exercise could result in functional benefits to patients with IIM, leading to an improvement in quality of life. In fact, recent studies of polymyositis (PM) and dermatomyositis (DM) support the notion that exercise training improves or at least stabilizes muscle strength and functional ability without inducing disease flares. Importantly, these benefits were observed not only during the chronic phase, but also in the course of active disease. This positive effect was found to be long term, as demonstrated by a six-month significant improvement in exercise capacity and strength. Together, these findings indicate that a well controlled exercise program can be recommended for patients with DM and PM. The optimal exercise modality training and the underlying mechanism for this encouraging response remain to be determined in future studies. (C) 2008 Elsevier B.V. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The genus Intusatrium Durio & Manter, 1968 is redefined based on a re-examination of paratypes of the type-species, I. robustum Durio & Manter, 1968, and is considered monotypic with characteristic terminal genitalia: internal seminal vesicle elongate tubular, with rather thick wall, divided by slight change in wall thickness into longer proximal and shorter distal region; pars prostatica subcylindrical; ejaculatory duct relatively short, with wrinkled/wall. The genus Postlepidapedon Zdzitowiecki, 1993 is redefined and Intusatrium secundum Durio & Manter, 1968 is attributed to it as a new combination. Postlepidapedon secundum n. comb. is redescribed from a paratype and new material from Choerodon graphicus. P. spissum n. sp. from Choerodon venustus, C. cyanodus, C. fasciatus and C. schoenleinii is recognised on the basis of its thick-walled internal seminal vesicle. I! uberis n. sp. from Choerodon schoenleinii and C. venustus is distinguished by the shape and contents of the cirrus-sac with narrow, convoluted internal seminal vesicle, large vesicular pars prostatica and short, muscular ejaculatory duct. A new genus, Gibsonivermis, erected for Intusatrium berryi Gibson, 1987, is characterised by the elongate narrow cirrus-sac and a uroproct. G. berryi n. comb. is redescribed from Sillago ciliata, S. maculata and Sillago sp.